Transcript Name :
Phymu_g2
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_532796
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat9.698PS50088
Ankyrin repeat-containing domain12.328PS50297
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-478
NN-scoreoddsWeighted Score
0.5831.8240.004
*** None ***
TypeScore
nuclear609
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1622 bases(100 bases per row)
ATGGTGGACAAGACTTCGCCGACTTCGACTGCGCGTCCGCTGGGTACGACGCCGTCCCTGGGCGCCGCTAGATCCGCTCGTGCTTCGAATCCTAAGCCAG
AGTCCAATGCGAAGCCGTCGCTGGTGTTTCTGCGGCTGAAACGCAAGCGTACCGACGACCCGATGGAGTGTTTGGTGGTGCAAAGTGAACCGGATTCGAA
GCGCTCTAAGGCGTCTACAGATCTGCTACAAGCCTTTACGAAGCTGTCGACCACTGAAAAGCGCTTCGTCTTTAAGCATATCGACACAATGGAGGAGCCT
ATCGCCCCAGGTCGTGTCAAGTGGACGGAGAGGCTCAAACGCAAAGCTCGTTCCCTTAAAGACGAACGTGCCGACATGTTGGCCAAGAAACAGATCGCTT
CAGTGTTCCAGAAGGAACCTACAGCCTCTAAACAGACTGAAAAGCGagtccaacagcagcacaatcgCTCTAAAGCGCGACGGAAAGAGGAAATGCTCAA
GTCCAGAGGTCTGCAGCCAATTGTGGAGATtaaggagaagcagacgatGGAGCTACACGGCATTCGACTGGTAGATTTGCAAATgtcaacagctccaagt
gcgGAACAGACGAaaaacgagaaggaggaggagattcTGGAGAAAAGCAAGGCGGATGTCGTCACTGTCAATGGAGCCAGACTGAAACCTACGAGAGTGC
TGAACCCGCACgagcgcgagctggacgaggccatTTGGACGGCTTTCCGCTCCAATGACTTTGCTCCTTTCTTCCAGATTTACCATGCGCGACGACCAGA
GCTTCGTGTGGACCCAACGACATTCCAACGACCAGCAGATGGAAGTACCATTCTCATGGCGGCGGCACTGCACGGACGTAGTGATGTTATTGAGGTGCTA
TTACGCGCTGGTACTACGAGTGTGCTCCAAGAAGACTGGGAAGGAGTGACTGCTGCGATGTTTGCGAAACGTGGTGGGCACACTAATGTGGAGACTGCAC
TGCTTGCGTGTGAGGAAGCGGAGCATGAAAAGGATTACGTTTACGATGTGTACTGCGTCGATATCTCAGCAAgtgaaggacaagaaacCGCTGCTGACAC
CGCCCCCCTCGCTGAAGGTAATTCGGAAGCGAAAACAAGTGTGAACGGTGTGCCAGTTGTCAGTGTGAGCTCGGAGGTGCACCGATGGCTCTCGGAAGAC
GCAGTGAGCGATGAAGTGGAGGAATACATGCTGGAGTCGGACATCGATAGCAACGATGAAGTTGACGGGTACGCTTGTCTGTATAGATATCCGTGGGACC
GCTGAGGCGTGAGCGGGGCCGATGTAAAGATCATAATTCTGAGTTGTTTTGACGCTTTCTGTTGCTTGTGGCTTGCCTGTTCTGTAGATTGAGCGAAGAC
TCCAATGACGAAGACAATGCCGCAAACGACTACCCGGACGAAGAGTCATCGGACGAGTCTCTGGTGGATAGCGACGACCTTGACGAGGTACGCGCGGAAA
AAAGTGTTTGTAGTATTTTCGGATGAAGTTCTGATGACATTTGCGTTCGGCAGATTGGGGCAAGCCGTCGTTGGCGAAGTTCCGAGAACGACTACACTGA
GCGAGACGACTTCGACTATTAG