Transcript Name :
Phymu_g28
Orientation:
(-)
Number of Exons:
10
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase S10, serine carboxypeptidase9PR00724
Peptidase S10, serine carboxypeptidase9PR00724
Peptidase S10, serine carboxypeptidase9PR00724
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2915
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
serine-type carboxypeptidase activityGO:0004185IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        12918 bases(100 bases per row)
atggagatgaagcgcgtggtggcGCGTTTCATGGTGCACAAGGTGGGCAGCTTCGTGGTTAAGGAGCGTGTGTTATGCTTCGGAGAATACTCGTTTTCGA
CATTGGACCGAGAAAACCAGCAGGTCACCAATACGTGGCCATATGAGGATGTGGATGGCGCCAACGTGCTAGAAGGCGAGACGGATTTCGTCATTCACAC
GCCTCGTCACCGCATCAAGAAAACTGTGTACCGCTGCCACTTCCGTATGGAGGTGCTAGTGTGTCTTATGCGTCTACGCAGCCAACACTACGCCAAGATG
CCCGATGCGCCCCAACCCCCGCCCGCtgagctgcagacgcacgcGTTTCAGAGCCTCAAGTACCACAAGAGCGGCGTGCAATCCACGTGCGTTGTGGAAG
TCCGCCCTGACGGCATCTATCAAAGAGACAATGAAGGAGATCTCATGAGTCATATCCCGTACACGAGTTTGGTCTCCATCGACGTCATCTGCGACGACCA
TGAAGCGATTGCGTTGAATCACTCGGACAATTCCAGTTTGTTCATTGTGCCAAGACGCACAGAGTTGGCACAAGCTATTAGCAGAGTTATGAAAGCATAC
GGTATGCAGATCAATGAATACCGCAAGAAAACCATGGAGGCGGCGCTGAAAGATGATGGGAAAGCGTCCTTGGGCACCAGTGTGTCGTTTGAGTATCAAG
TGTTGAAGGTTTCGCAGTCAAATGAGTCCAGTGCTGTTCCACGCACACTTTCTGTATCAGAGAAGTATATTACCGAGTATGCAGACGCCAAGACGGTTAT
TTCCAGTCGGCCATTGGCGAGAATCTACACTTTGGTCATGTATCAAGATACACTGCAAGCGTTTGAAGTCGTGTACGCGGACGGGGTCAAGCGCAAGTAC
TATTCTGCGCagcgcgagaagatcgtgtgTGAATTACTGGCATCGTGCCATGCACTGGGAAACTATCAAGTCGGTGTGGAGATGACTGAAGCTGCGGACT
CGGTTCGGATGATACCGCGCAAGATCATTTTGCAAGAAGGCAACAAGATTGCAAATACGGTACCGAACGTGAACGTGATGGACCGTGAACTCCGTGTAGC
ACAAGCAAATGTCTTACAACTGCTTGCAATACATGGCTATCGCAAGACAGCACGGACCCAACGGCAACTTCCTCGTGGCCTTGATGAAGAGATGCACTCG
TTATCGCTAGAGCTTAACGTCAATACGCCTACTTCCGGTGTGATCGCACAGCCAAACAAGCCGTTCGATAAGGTACTCTACGTCCTAGCACGTGAGCTGC
ACGACATTGTGGGACGTCATGGTGCGACGCACGATTTTGTGAGTACATACCTTCAGTCACTCTATCGCTTGACGTTGGCACCCCCTGCTATCAACGAATT
CATGAAAATTCTGACAGAGGTACATCACACTGCTTTATTATGTTCCACTGGGATTAAGCTTAGTTAATTTTGTGCTCGTGCGTGCCTTGCTTTAGCGTGA
GGAAGAGTACATAGGCACAATATCCAAGATTCTGGTGAGCAAGAACTCGGTTGCTATCTACTGGATATTCATGTTGTTGAGCCGATTGATGGAGTCGAAA
GCACACAAGCTTCAATGTCGACAACTCCTGCTGTCCAATGGCCTCTTCATGATGACACTATTGTCACTGCTAGACGAAGATACACACGTAAGTCGGACTA
CCGTTGATATCATGATTGCACTGTTCTTACACGACTGATTGTGTATTCTAGACTGGTGCATTCTTGTCGGATCTGCcaacgatgaagctgtgcCAGTTTA
TTCTGTTATTGGTGAAGGCAAATGTTGAGAAACAGCGGAAACTATCAGAAACGCTGTACCAACACTTGGCGACAAAATACCGCATGATGCTGCGAATTCT
CTTTGGATTTCCTGCCTTAGCTACCGTGGAGGCATGCGTGGGAATTCTTAGCAGAATGACGAAAAACCCAGCGTTTCTGCACTTTGGTAACATGGGATCT
CCGTTACGATCCAATGATGGGAAAATACCTCGGCAATCACTCAGCTTTGGCGAAACATTGAATTTTGGGCCAGGCAGTCAACGTGGAGCACCAGTAGCCT
CTCTATCTCGACCCCCGTTGTATTCTTCTAGGAGAAATAACTACGCATCCAGCCGAAACAACACATTCTCGTCATCGGGGTCATCTTCTAGTGGTGGATC
TAGCCTTCCAGCTAGCGTTGTGGTTGTTCAGAACCCGGAAGTTCTCATGCGGCAATATCGACAATTTCTTGAGGCGGCATGTGGCTCATTGAAGATGGGG
ATTGATCAATACGACGACTCAGTCTTCTTGCGTCTTCGCTACAGATGTCGCAACATTTTTTTGCAGGAGCTTATGAGTCATTTGGTGGGTAACTTTGACG
AGTTCAAGCGCGTATATAGCGTTGATTGCAGTCATTTTAGCGGTTTTATCGGGACAGCCGATGGGCAGCGAGAGAAGACCAAGTATTATTTGACCCCGCG
AGCTTTGATTGCTGTGAGAATCGTGACAAAACATACTCATGAATTTGAGTTTCGCGCAATTGAAGAGGTTACTCAAGCGACCTCGATCCCAGATGCATTC
ATCCTCACAGTGAAGAACAAACTGAAATTCATTTACTCCGACCAGAGCAACGAAATCGTAGAAAAGATGAAGGCGTTGGCTGGCGTTATTGGAATCCATC
TTCGATTCAAGACTCGGGACAAACTTCCAAAACAACAAGCGGAAAGATCTCTTGACCAATCTGCTTTCCAATCAAACGACTTATTTGATGTTCAACGACG
GACTGGCAGGCATGGATCCACGCACTTGCGGAAAAAGAAGCTGTGTTTCATTGACGGAACTATCGAAGAGTTTACCAATTGTTCAAAGAAGTCCTACGAT
CTAAGGAATTTGCGGCGTGTAGTGGTCCCTGGATTGGATAGTGACGATACCCAAACTGTGGTGGCCTTGGAGTTTGTGGATAGCAGCCGTGTTGTTTACG
TGCCATACGATATCGATAAGTTTCTAGCAGCACTCTATGACGGGTACCGCTACGTCGAGAATTACGATGTATCGCGAAGTCGAGAGTTTTCCAACTTGAA
CCCGAGAATGTCTCCTCGAGCACTGCTGAAGGATGAACACGAACGATTTCTCTACCTCAATCATGATAGCCTCTACATTCCAGCACACGTCATTCTGGAG
AAAGAGATTGAAATGATGACTGGTGAAGATGTGAGTATCACATCCGCTACAAACAGAGTTGCTTTTGCGCTGGAGAGCTTGAATATGAATGTTGAGATCG
AGGATTTTGCGGGGAAGTCGATGCGCGGGCGCTTGGAAAAGCTATCTTTTAACGCTCTGCTTCGGGGGATCAACAATATGGTAAGAGAAATGGATAGATA
TCCTGTTTGAGATGTGAAAACTGACGTCTTCTTTTTGACATTCTTCTCGGCAGCTTGAGCATTCCTGTAAACCACCTATTCGTGCGAACGAGATTTGTGT
TATTCTCGAAACGTTTTGCCGGATCAACGACGGTTGTTATCGGCTTGCGATGGAACAGTCAAATGGTGGCGCAATGGTACTTGTTCCTACTCTCGCTCAG
ATATTGGTATCTGGGGATTCGATTGCTACTGTTTGGGCCGTGAATGCGCTTCACTCACTTATCGCTGATAAATCACGGTCAAATGCTCATCGGGCAGCTG
AGAAGGCTATTCGCTTTCAAGTATTCGAGCATGGTAAACTTATTTCGCTATTAACTGGTCTTTTGGAACAACGTAATTCAAGCTCCACGCTAGTACTGCT
GCAATTGGTCCTGGATGTGCTGGTGGTTTCTCGTCACAGTACCGATAACAACCACTTTGATGCCATCGTGAAAGATCTTGGAGGGAAGTACAcactgttg
ctggagctggcatCTCAAAACTTGAATGCGGGattggctgcagctgtcATCTGCGTCTTAAAAGTGATTGTTGACCACGGTGATCATAAATTACGGAGGC
GAATTTGCGACGTTGCCTTAGATTCCGGTCTAACTCTCAAACACCTGCGCAAAGCGTTTTTCCACCCGTCCGACAATGCAAAGGAGACGTATCAGTACAT
TGCCAGCATATGGGTGACTCATCACAAGGCTTCACATGAAATGCTGGTGAGAATTCTCCCGCATGGCTTTATCCGGATGATTTCAAGCCCAATGGTTAGA
AAATTGTTGAAAAAGCAGCGAGCTCGACAGACTGAGTCTACCCGCCGGAAAAGTAAGCACCAGTTACAGAGCCAAGTTGATGGATCAGCGTGGTTTATCC
GCCGCATGCAGCTCCAGATCGGAACATTGTTTGCTAGTGGGTCAGTGAAAGAAGCTCGAGTCAAAGAGGACCCCTCGCGAATGAATTATCCTGGTGAATC
ATCAACAGACATGGCGTTATTGTCGAGTATGGTTAGCAAAGATTTTATGCTTCCAGACTTGATTTGGAACGAGGTTACGCGAGGTGAACTGAAAGTTGCG
CTCACTTCGGCGATTGATGAATTTGAGCAATTTAAAGCTAACCAAGCGGTTGCATTATCGTTAGTGGCTTCTCGGAAAGCAAGCAGTGAACCCAAGTGGA
ATCACGCCCAGTTTTCAGTGAGATACGAAAGCATCGCCCAGGAGCTTCAAGTTGATCGGTTTTATCTACGCGTGATTACGGAAAGAATTAGTGACGGATC
GTTGCAGTTGACAGAAGTTGCAAAAGTTGTTCGCTCGATGGAAGCAGGGACATATCGGGGAAAGCTGAAAAACTCGAGCAGTCTCTTTTTCGCCAGCATG
GATATTGCGAAAGATCCAGCAAAGTTTTTCAATGAGGTGTATCAGTGTTGGTTGGAGCATCTTCACTTGAACAACATTCCGTTATCAGGAACGAGTGATT
GGTCTGCAAGTGGGAGCAATGGATTCCCTCAATTTACTGGCGCAACAGGAAGTGAACAGCACGGCCATTCAATGCTAAAAATCCTGATTGAGCTAGCGAA
TGTCTTCCCCGAAACACGACCGATTACTAAGCACCGGGCTCGCTTTCTTACAGAGTTATTACGGAATTCGTATTTGGCAAGTGAAATCCAAGATATTGTG
GAGTTGCTGTCTGGCTTGAGTCTGTCTGGAGACACCTGTGCCGAGTTGTGTACAAAAAACCACATTCAGGTTCTGTTGTACATGGCCTTGCTTTCACACA
GACACCAAGTAGCTCCACTGGGAAGTGACATGACGAACGATCTCGGCGATATACCAATGATGGATTCATTCGTGTCTGAAGCGAATGAGACCTCATCCGT
TCCGATTGCAGAGCTTTCATTCTACGAAGAATCAAGATATTCGCTCAAGTGGAGCATTAAGCTTAGAGCTGTCCGAGAAGCAGATAACACCACTACGCTG
AAAGGTCCATTTTCAGCAAGCGACCTGAAAGAATATTTAGACGCTGATCCTTTCATTCGGCATCGCCAGATCGATGCTCTGTatgtttgctgctgctcga
cgcaTCCTGATGGTGAAGAGCACGCATGGAAGTCGATGTTTGAATACCCAGAGCTGCGTTGGATGGAGTTGACGGACGAACCCATTGACACAAATTGTGC
TATGTTTGCCTTAAAATCGCTGAGGAACTGTATGATTAAAGATCAACGCAAAGCAGCGGCCGGGAACAAACATTTGTGGCCTCCACCTTTGGTGAATATC
GTGGTGGCTAATACGTCATCGCTAGCTTTATTagttcagcttcttctcgtaaATAACCCGAACGTGCGGAGATACGTCTGTGAGATGCTGATGTATTTAA
AcgatgaagaactggatgagCTGTATAAGCACGGAGTCTTCTATTTCATTTTGGCTGCGGCTGCGAATCGCGGAGGGGCCGACAAGGAGTCTGCCTTCGT
TCCAGAAGCAACACTGCTAAAACGAATTCATCGGATCCAGCGGCCATTGGATCGGTATGTGGGTCAGAGCTATCTAACTGACATTCTGCCCGAATCACTC
ATTGGACTTTTGGACTCGGAGACTCCTGAGCTATTTGCCGAAGTGTATAGTGGGCGTAAGCGTGACAAACGTGTTTTGTGGTCGTCGACGATGAGGTTAC
ACTTGCAAGAGATGATTGATGAGCACCTACGAGACTTCAAGGAATGCTTGAAGACAAACGTCACAACGAAGTACAACTACACTCCGATTCCTCCGATTTC
GTATCTGGAATTGTCTGGGGATGTATACTGTAGCGGATTTTATCTTTCGACTTTTAACCAGTCTAATTCGGATGttgaggaggtggaagatcCCGTTTTT
ATGATGAAAAGTATCGAGGAGAAATGGCGATATCTGGCACGTCGTAAGGCGGATGGAATGGAAGACGATATGGATCATTCAGATGCGTACAAACTATTTG
GCTGGAGCGAAGACATCACGTTTTCGTCGTCAGATTTGCGTTCGCGCTATCGAGAGTTATGtcagcaacaagttgaatTGGCAGCAGTTCGTCAAGCTTT
TGATTCTCTGTGCAGCGCGCTTGAGCGCAAGAACGAGGCTGGTGGTGGAAAATCATCGGATGATGTTATCGAGCGTATTTTGAAATCGCAgatgcagttg
ctggacaagtacggTTTTCAGTTTTTCTCGTACGAGTCTTCGACActtgaccttcttgtccgcGTGTTGTCTTCTCGAACGGCTAAGGAAGCAAAAGTTC
GATTCCTAGCCATGCAAGTATTGGAACGACTTTTATCTGTTGCACCTCAAAATGGCCCACTTATGGTTTTGATCGACGGTAGTTGGGACGCCGTCCTTGA
CTTAGTGGAAAGTTGTGCGTATGGCCACGACGTAGCAGCGAAGGAGATCATGTTTTCGATCCTAAAATTGATCCTTATGTCGGAAGAAGGAGTTCAATCG
CTTCTACGGGTAGAAGACGATAAAAATGGTTCGAATTCGATTCCGCCATCCAAGACATTTGACTTTAACACTTTCGGGGATGATGACAACACGTCATTTT
TTACTGCGACGGAATACACGTCTCAAaacggagctggaaaatCTAGGTATGCGCAACGCGTGTACTCATTGCTGGATGATGTCATTCTTTCATTCGAGAA
TATCCAACCGTGGCATATCCAGAAAAGGTCGTTTGAGATTGCATCATCGCTTTGCCGAAGTcacgagctgcaacagcaaatcATGACTTCCACACGGGTG
TTTTGGAAAGGTCTCTATTTGATCTTGGCTTCTGCCGAAAGCTCGTCTGGAGTTGATACTACCCAGGAAAGTATCACTGCGTTAGAGAAACAGGAACGAG
ATATGTTGGAAAGCGCttttggagctcttcgatcgCTAGCTTTGGGGCCAGATGGCAACAGCCGATCTGCAGGACTAGAAGCTCTAGCTAACCTCCTTCC
GATGGACTTTTTGGATCGCCTGGAAAAGCCAAACGGATATGATTTCTGTACAATTTTACTGTCAGATATTCGGGAACCGACCTGCATCTGGAACGAAAGC
ACGCGGAACGAACTATCTCAACTGACGGAAGAGTTTTGCACGGACCCTAACGATGATGGAGTCTCGTTTTTAGAAAGTGCGACCAACTATATGTACGATT
GCCTCAGCTCGGAGCCGTACGTAGGAGGTATCTACTTATTGATCTTGCTCGAGAAGTCGGAGGGAAATCCTCACGTGATTACTGAGGATATGCTTTTCCC
AACTACTGCTGTGGACTTCATTGAGTCCCTCTTCTGCTTTTTAAACGAGAACAGGGACCCAAAACTTGGGATTTATTCGGATACAATGCCAGCGTTGGAC
TGTTTAAGTCTTCTGTGCGACTTGCCAGCCTTTCGACCTGCAATTGTGGAGTGCTTGGAACAGCATATTGATGACGAGGATGCGGTGAACGCGTCAATAT
CGGTTGCTACACTTGGTAGATACCTATTGCCATTTGATGGTGACGACAAAACAAAGACGGGGGTATCAATATCGTCGCGTCGGTCGTTGTCGACGTATGG
ATTTAAAGCTAAGGCTGAAGCCGACGACGCCCCTACCGCCATGGAAGCCGAGTTTGGGAATGTGGATTATTTGGCTCGACAAGAAATGGCACTGCTTATC
CTAAACAAAATCTGTGGGTTTGAGTGTAATCTGGAACGGATGTTGGAACCATTTTGCCAGTTCACGTGGTGTCTTCAGGTTATCACGGATCATCTCGGTT
TTGAGCAAGCATATTACGCACTGTCATGCCTGGCCGAATTGTGCGACACTTGTCTAGTCATTGCCGAGTACGTGCAAGATTGTGGTCTATGGGTTGAGAT
TCTGGGTATTGCACTCCAATCAAGACAGCATGTTCTTCACGAGCACTTCCTTCGAGCTGAGGCGCTGCGAGGACCTGCATTTGAAGTTTTGTACGCGTTG
CTGATGAAAGACTTGGAGTTGCGAGAAAAAATGTACAGTGGGCTCTGTCGGTTTCTCCCCTACCCGATCGTGTACCAAATTCATCTGGATCCGAACAAGG
CTACGCGATTCTTTGATGACAACCACCAAAAGAGTGACTTGATTTGGAATTCCCACCGACGAACGGAAGTACGTAAAAAGCTCGACCAGATCATCTGTCG
AAACCGGGCAGAACGATCGCTTGGCAAGCGAGACTCTGTTCTGCTCGATGATAAGACAGATTTTATCCCGGCTCCCGAAAACTTTGTGGCGGGTCTGTAC
ATTGATCGGTTCTTGTCTCGACCAGATCCAGAAAAGCTGACAAACCCGTCGTACAATTTGGAATTGCTTTTCCAACTATGGAGAAGTCAACTAGACCAAC
TGATGAGCTTTGATCTACAAAATCCCCCAGACAATCTCAAAGCTGTGGCTGATGAAATTGACCAGTATACGATGGCTATGACGCACATTTTGAGGGCGTC
GCTTGATGTCGACGAAACCATCGCTGACAATCGTATACCCGATCAAATCGTAAAGCTTGTACGCAACTGCAACCAGAATTTGATCACAAGCTTCCCGTAC
CGCTGTATTCTGCGGATCGCTCGGCGTTTGGTGCAGTTTCCAGAGATGACCTCGAAAGAattcgtggagctgcttaTTTGTAGAATTACCATGCAGCACC
CCGATATTCCGTCCttgctgaaggtgctgcgTCGTGTATTGGAGGCTCGCAGCACGGCACTGGTAGAGAACGGGACGAAAGATGACCCCGAGTACTGGTT
AAAAGATCTCAAGTACTACCCTCAAATGCTGGCCTTCCTGGAAGGATTAGTGGAAAAcaaggagcagatcgaggccCCTCTCCTTTCGAACGTGAATCGT
GTTCTGCGTATTATTCATGCTGAAGAACCGAAGGAAACACATTTGAAGCAGATATCGCGAAGTTTCATGGGACGCTGGCACAACTTCACACTGGAAAGCC
GCCCTTCGATGCTCCGTAACTCGATTAAGACTGGTCAATCAGAAACGAAGCCGCCAGTGGGCACTGGGGCTACAAATATCGAATCAGCCGACCCAAACAT
TATGAGTACTCAGAGTTTCGACGTGGACGGAGCAAGAGGAATTCCTGCAAGTGTTGAGAGCTTTGACGTGGATGGAGAGCGAGAACCTTCTATTCGTGTC
GATATCAAGAGTATTCCTCCTGATCGTGAGGTTGATATCGATGGCACGTTTATACAAGCGCCTCCAAAGAGTATCAACTTTactggtggagctgtcgagt
TGACAGAAGCTATTGCTCCCCGCAGTTTCCGGTACAAGGGCGAAGACATTCGCAATTCCCCACTGCCGTCTCCCACATCGGTCCGTTATTCGACATTAGG
AGCTCGCTACGAGCCCGTCGATTCGCGGTATCATTCCACAAAGGCAGCCGAATATGATGAtcacgaagacgacgaagacatcTTCGCGACGCGGCCTCGT
CGTGGCAGCTTGCCGTTGAAACCAGACGACGTTGACGTTAAGATGGTCAACGGCGACAGGATAACGTCAACTGCAGCTGGTGACATTCCTATgagcagca
tcaacgtcagcaacttcatctcGCAAGCGCCAACTACACGTCGTCGTAATCAAGCAGCGGCTGAGATCCCATCGGATACAACGTCGTATTTGAGCCGTCA
AAGTGGCGTGAGCGGCATGAGTGGCATGAACTCGGAGCGACGGTAttcgctgctggactcgtGGAAGGCTCCATCCTCAGCAGCGCCAAACTCGTCGCTG
ACTACGCTAACCATTTCCCGACGAGgtcgtcgagctgctgcagtctACAGCCGAcacaagtccaagaagaaacgctGGTTTAACAGATAGTTGAAGCTGC
ATTTTCATATTTCTTTAAAAATTCTGGtaggaccatcactccttATTTCTTTAATAACTATGTTTCAAAAATATTCTGGAAAATCGtttttgaagttgaa
gaccatcactcttgtAGCGAGATGAGTTTGCAGCAGAGTCTGCCGCAGCATACTGTAAGCGGCCACAGCACGCTGAAGAGGGATGAAGATCTTACGGGAG
GAGACAGCAGCTTTCTTCGCTACATCAAGACGCTGACAAGTCACCAAACGAACGCTAAGCAGCAGCGAATGGACCAGTACATGCAAAAAGTCAAGTACGG
ACGGACAGACAATTCGGTCAAGAACGTGAAGGCGACAGGATACAAGCACCAGTATGTGCTGAAGCCGTCCGTGTCAAAGGATAATGTGGCAGTGCCGCTA
TTGTCGAAGGGGAAATCCCCAAAACCGAATACCAAGCTGAATAGCAGCAAGTCATTTGCACAAAGTGAGACCAGAGTGCAGGGAGGGGAAACTGGGCCAA
GGAAGAGGCTGTCTTCGAAGCGTTCGTATGAAGAGAATCCATTCAATAACAGGcagcggaagaagacaaagCGTGAGAAGCAGATCATGGCTGTTGACTC
GCTGGATCGCTTCAGGTTCAATAAGACCAGATCTCCAGGTAGAAGCGAGAAAGCTGTCAGCAAGACGCCCCAGCATTCCGCTGTTTCAAACGGAAAGTCC
AAAACTTCTCAACTCCCAGGGTCAACGCGCGATACGCAGTTTAATTCCCAAAAGCCCGAGTTTAAAGGGGTGGCGTCTGCTCAGGTTTGCCTGTACTGTA
TAGCACCTTGATTCACGAGCCGTTTTAACGTTGATATGgttgacagcagcaggcgacGAACCCACTTCCACTCATGACATTCAGAGTTCCAactcaagct
gctgctcacgatcCGTTCGGTAATTTGAGCCAGCTCAGATTCCAACCACCAGAGGAAACACCATCGGGGAACTCCCAGTACGATATTCCAGAGCAAGAAG
TAGCAGTCCCCGCTTACGAGTATCTTGTCCCCCTCATGGAGTCGATTTTCTTTTGAACCAGTATGCAAAACTTCCGTAACGTCTTCATCAACCGTCTTCG
ATACGACGTTTTGAGGTATCTGCGACTAGAGACTCGTCATTCGCGATCTTGCGTACAACTCGTCATCGAAAAATGCAGGTTCACGCTTGGAGCTTGCTCT
TGGTGGCGCTAGTGGCGCAAACTTGGATGCTTTCAGGAGGGGAGCAGCTACTTGCTCAAGCAAGTGACCTCGTCGAGGAATATCCGACATCAACGTCGCT
GTGTGGAGAGAATTTTGCCAAGGAGACCGGCACTCTCAACAATCTCTACTACGTGTTCTATCAATCTTCCGCCGTGAAAGTTGCTGTTCCGCTCATTTTG
TGGTTGTCGGGTGGTCCGGGGTGCTCTGGGTTGGTCGCGTTGCTATTCGAAAATGGTCCTTGTTCGTTTGATGATGAGACAGACTCCATGTTGCTCAACC
CGTACTCGTGGACTGGACTCGCTCACGTTATTTATCTCGACCAACCTAAAGGTACGGGATACAGTGATGGGAATAACGGAATCACCCACCCTTGGTCACT
CGGAACTGCAGCGGGCGACATGAAggagttcctgcagcagtttTACCTGCAGCATCCAGAGCTCAAAGCGAACGACTTTTACATATTCGGCGAGAGCTAC
GCAGGCCACTACGTACCAGATTTGGCAGTGAGAATGCTTGACGAGGACCGCTTACTTCCGACGCTGAAAGGAATTGCAATTGGCAATGGCGTAGTGTCCA
CTACTGCATGGGCTACGTCGGTGCTCCCATTCTTCCGGTCAAACGCGTATGGATACGATTTTCTTGGCTCGAATGAAGAGGGATTTCGCGAACTAAGCGA
TCGCTTCGAGTCGACGATTGCAAACTGCATAAGAGGTGGCAATTTGCGCCATCCTGACAGTATCAACCCCGACTGCGATACGGCTCTGCAAACCCTCATC
AATATTGAGGGGGGCACTGCCTCCGCTGTCTTGAATCTTGGTCGAAACGTATACGACGTACGTCGCGAATGCCATCAGGACGACACCCTCCAGCTGTGCT
ACCGATTTTCCCGTCTAGAGACGTTTGTCAACaccccagcagcaacagcataCTTCGACGAAGCTCCTCACAGGTGGAAGCTGTGCTCATCCGGAGCACT
TCAGCGACTGGCAGCAATGGACCAGCTagaagagagcgaggcgAATGTCGCCCAAGCGCTTGAGCATGGCGTTCGGGTGCTCGTCTACGGAGGTGACGCC
GACACCGTCGTCAATTGGATGTCCCAGGATTCCTGGACGCGTGATCTCTCTTGGATGCACCAGGAAGCCTTCAGATCTGCCACCTTCGCCGAAAAAAATT
TTCATGGCCGAAGTTTTGGCCAAGTGCGCACTTCCCACGGCCTCAGTTTCATGCGCGTCTTCAATGCtggccacgtacgtgtcCCTGTTACTTTGTTCCT
CAGCTCTTGTCACTAATCTGCGTCTTTCCAGATGGTTCCTCACGATCAACCTGCCATTGCGTACGAGATGGTTCGCAGCTTCCTGTTCGATGATCCAGGC
TCCAACATGTTCAGTTAG