Transcript Name :
Phymu_g36
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Saposin B11.374PS50015
Saposin B10.188PS50015
Saposin B8.831PS50015
Saposin B9.424PS50015
Saposin B9.096PS50015
Saposin B11.764PS50015
Saposin B12.279PS50015
Saposin B10.641PS50015
HmmSmart predictionP-Valprediction_id
Saposin B5.6SM00741
Saposin B2.3SM00741
Saposin B1.5SM00741
Saposin B0.29SM00741
Saposin B5.8SM00741
Saposin B2.8SM00741
Saposin B2.3SM00741
Saposin B4.8SM00741
Saposin B4.4SM00741
Saposin B0.38SM00741
Saposin B7.9SM00741
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Saposin BIPR008139
Y-scoreD-scoreY-pos
0.8170.82418
InsideOutsideTMhelix
1-1346
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4325 bases(100 bases per row)
ATGCGGCCTGTGTACGCGCTCCTGCTGAGCCTGGCGGCCGTCACGAGCGCCGAGCACATGCACGGCGTGCGTCACCAGCCAGAAGACGCGGAGATGCCGT
GCCACAATGAACAGAAGAGCGAGGGCGAAGACTTTAGTATGGGGCTTATGGCCGCACTGAACGAACAGTTCCAGCGCTCCAGTGAGCTACTGCAGAGCTT
TTTCCGCCTGGAAGAGCCCCAGAATGATGCCGTGCGCATTGTagtgctggaagtggaggaagatcCAGCGAAGGAAAGGCAGCGCGCGTGCTTGAAGGCA
CTGGAGCGGATCCACGAGCAGGATGAGCTGCAAGCCGAGGCGGAAACGCTGATCCGGTACTTCCGTTCAGCTTTCGACAAGGTCTCGCTGCAGGTTTGGG
GGGAGACGTCGTGTGAGGACCTCGAGCAGCCCGATCTGATCGAGCAGGTGAGGAATTATTTGCTGTTGAAGGGAGGGAAAGGTGTATTAATTTATTGTTT
ACTGCATTGCCAGTGCAACGTTGTGTTGGAGTCGGAAAATGTCGTGAGGAAGTTCTTACTGGAGGGTAAGACGGACGACCAAGTGTGCGACATCATGTCC
GCCGTTACGGACCTGGAGGGGACGGACAATTTGTCTTGCAAGTTGTGCCAGAGATTCGTGCAGATGGTGGACCAAGCGCTGGCCGATCAAGTGcaggaag
tgcagcaggTCCGAGCGATCATTGGCGACCTGTGTGACGCCATGTCGACCGACTCAATGTGCCACACATTCCTCAAGAACTTCGATGCCATTGTGGACTG
GCTCAAGCACGGCACTGACCCGCTGGTGGTCTGCTCCCGGATCGCTATGTGCTTTCcggacagcagcagtggcagccaAGTCTCGGATCTGCCATGGACT
CCCGAAGCACCCAAAGCGATTGAAGATACGGCTATGGTTACCGCTGACTTTGTTGAGAGCGACCAGgcgtgcttcttctgcagtcATGTGGCTGGCGTCA
TTTACCAAGTGAATGAGCTGTTCCCTGAACAGCTTCCGATGCTAAAATCGGTCTTGGGAACGGTATGCGAGGTGGCTTCGCCGGAATCCAAATgcctgga
agtggaggccAACTTTGACCGCattgtggagctggtgcagcaagGTCAGCACCCACGTAAGGTTTGTGCAAACGCTGATTTCTGCGCCGCGAAGCCTGCA
CGTGGCATGTTACCCTCAGATTCGATCGGTGGTGACAAAACGTGTGTTTACTGCGACGCAGCCACTACTGTTGTGGAGGTTATTCTACAAGAAGCCCCCG
AGCAGATTGACCAAATTCGCGACTACGCTGACATGATTTGCGGTATGCTGGGGGATGACAGTCCATGCCACGAGTACGTGAATCAGTTGGATATTGTGGT
TGACTCCTTGAAGAAGGGAGTGCACCCTCGTGACATTTGCAAGACCTTGAAGTACTGCTTAGCAGAACGGATGGACGGTCCTTCTGAATTGGACGAGAAC
CCTCGTGTCGGCATGATGAGAAATGGCCCTAGTGGCATGCACCATCACGTAAGTATGGTGGGCCCTGGCGGCCGCCATGGACGCCACGACCATGGCCCGC
GTGGAAACTTGGAAGATGATGAACACCCACCTCACCCTCCTCACCCGCGTCCGCACCCCCACGGCAgttgcttcttctgctcgcgTGTTGCAATGGTTAT
CCACCACGTTAATCACACGTCGCCGGAAAAGCTGCCAGTTGTGAAAACCATTTTGACAAACGTATGCCAACTGGTGCCTTCAAAGTGCAAGTGCGATGTG
GTAGACAAGAACTTCGACAAAATCGTTgaaatggagaaggaagGCAAGCACCCCCACGAAATCTGCAAGTCTCTCGGCGTTTGCAACAAGACGCGAGACT
GGGAGGAAGATAAGCCTTCCATTGCCGATGAAATGAAAGGCGTGGTTGTGGCTTCTCGGTGGCCTCCTGGAAACGCAACCCAGTGCACGTATTGCCAGTT
TGCAACCACTGTGGCCAAGATCGCGCTCCAGCAATATGGTGCCGACATTCGCCAAATTCGGGCGTACGCGGACATGATTTGTGATATGCTGGGCTCGGAC
AACCCATGCCACGTTTACGTGAAGGACTTTGATTTCGTCATTGACTCGATCACCAAGGGTATGAGCGCCAAGGCTATTTGCACAGAACTGCAGTTCTGTA
CAGCAACAGAAGGGCACCTAACTATCGCTGATAGCGAAGAAAGTGCTGTGGTCTTGAGCTCGGAAGAGCGTCACCACCACAACCACAGTTGCTCCTTCTG
TATTCACGTTGGCATTGCCATTCACCACGTCAACAAGACGGAACCAGGAAAACTCCCGATTGTAAAGACTATTCTGACGAATGTGTGCAAGCTGGCAACT
CCTGACTGCAAGtgcgacgacgtggacaagaacttcgacaagatcgtggagttggagaaggaggggAAACGCCCGCACGAAATCTGCCAAAGCATTGGGC
TgtgcaagaagaaagtggaTGCGATCACAGACAGCTACTCTTTCACTGATGCTGTATCGGCTTTGGTTGTCGACAGTTATCCTGGTGCCAACGGACCTGA
TACGAAAacgtgcttcttctgcgacTACGCCACTACCCTTGTACAGGCCGCTTATGAGCAAGATTCGACGAAGGTCCTTCAGATTAAGGAATTGGCGGAT
ACTGTTTGTGCGCTTCTGGGCGAACACTCTGGGTGCCACCAGTACGTGATAAAGCTAGACTTTGTCCTGGACTCGGTGAAGAACGGAACACACCCTCACG
CTATCTGCCAGTCGATGAATTACTGTGCGGCCAACGACACGTTGCTTGCACCACAGTCCTCAGGCAGCGATTTGTCTGCTTATGACCCGATGTTGGTGCA
AATGGTGAAAGAGTCGATGGAAGTGTCTGTGGACGGATGCTTCTTCTGCACTCAAGTGGCATCCATTATTGAGGTAGCTGTGGCTGAAGACCCGAGCAAG
ATTTCGCAGATTCGACAGATTGCAGACGTTGTTTGTGGAATGATGCCGAGCGACAACCAGGTGCGTTGACTCGCAACTCCGAATTGCTTTTGAAACCGTA
CTGACCATTCCTCTGTGTGTGATTTTGTAGTGCCACTCGTTCGTGAAGCAGTTCGATGCTGTTCTTGATTCTCTTCAGAAGGGCGAGCAACCGAAGGCTA
TTTGCCACGACCTGAAGTACTGCTCCGTGGACACCAACCCGGCCATGGCAAAGCTTGCGGTGCCCGATATAATCGCTGTTCAGAACAGCGACATGGGAAG
CAACTCGTGCGCCTACTGCAGTGGCGTTGTCACCGTTCTCAAGTATGCGCTTGCCCAAAAGCCGGAACAAGTTAAGGAGAtgcgtgaagctgcaggcaTC
GTGTGCCAATTGCTACCTACTGACGACACAGTACGTGGCCTTGTGAATTATATGCTCTGCAATGATGCTAGGAACTGATGTGCATTCCGTTTGTGCGTTT
TGAGCAGTGTCACGACGACCTGAAGATGTTTGACGAAGCAGTGACCGACCTACAAGCTGGAAAGGAGCCCCAAGAAATTTGCCAGACGCTGAAATTCTGC
GCTGCCATGGAAAATCCTAGCGGGCTGATGTCGGGTCTTCTTGACTTCACGGGCAAAGACTTCCTGCCTTCAAGGTGCGCTACTTGCCAGCAGAacactc
tgctgctcgcttcGTTGATCACGCGCCCGGACAGCCTAGTCACGTTTGAGCGCGAGATCGACTCGATCTGCCGATTGATCCCGGAGTCCAGTGAGGTAAG
TGTGCTGTTTACATTCAGCTTTTGAATTGAGGCGTTCCTAACTCGATACATTTTTGTATAAAATAGTGTGAGCTACTCATGAAACATCAAGACGCAATCA
TTGactcgctgaagaagaacgaagACGTGGATACAATCTGTAATCGTATTGCGGAGTGTGAGCCTGCGGTtgtcaaggagaaggtggaggaaaAATCGAT
GTCTGTGGGCTGCTTATTCTGCGAGTACACGGCCGATCTCTTGGAGCAAGCCAAGGACAACGAGAAGGTCTTGCGCGAGGCCAAAATGACTCTGGAGACA
ATGTGCACGGTGTTGCCTCCGCGTGCGCGTTGTGATGTGCTTTCCTCCAAGTTTGATGAGCTGGTGGTACTAATGCGCGAGGGAAAGAGTCCCAGCGAAG
CCTGTCACGCCATCGCTTTGTGCGACGCTGACTTTGTCTTCTCAGGAAACCGAGCGGATGACCCTATCGTGCAAGCTTTCGAGAACGGGCGGCAGAGCAT
GGGCAACTTGATGGAGATCCAGTAA