Transcript Name :
Phymu_g19
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Bromodomain1.5PR00503
Bromodomain1.5PR00503
Profile scan predictionP-Valprediction_id
Zinc finger, PHD-finger10.282PS50016
Bromodomain15.673PS50014
HmmSmart predictionP-Valprediction_id
Zinc finger, PHD-type7SM00249
Bromodomain8.3SM00297
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-977
NN-scoreoddsWeighted Score
0.5211.3040.003
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        3354 bases(100 bases per row)
AtggacggagcagcaggataTCAAGGGAGGCAGATGAATGCTTCGGCTGGGTATCAGGAGAGAACAACCAATGGACCTGCAGGCTATCAGGGGAGAATTG
CTGATGGATCTGTGCCCTATCAGGGTAGACTTATTCAGGGCTCTTCTGCTTATCAGGGGAAAGTTGTCGACGGTACTGCAAGCAAGATGTATCAGAACAG
ACCGGTgccaacttcttcgtcgggAAAGATGGCCGAGGACTACAAGAGGGATAGGAAGCTGCCTCCCAGggtggaggaaatgctgaGAGAACAGGTGAAC
CTGGATGAATCCGTCCTGCATGATGCGTTTGCTGTCGCAATGGAGGACCTAATCccggaagaggaagccaaCTTCATTGCCAAGGGACTGTGCCACCTGT
GTGGCGTGAGCGAAAAGCACTATGTGCCTGTGGTTAATTTTTGCCCGCATGCGAATGAGAACCATTCGCTATGTCGGGAGCACTTGCGCAGCGTTTACAG
AGTGCGGATGGAAGCTTTATTCGTTGGCAGGAACGGATCTGCACCGAATCGCCGCTTGTTGCGTTGTCTGGTCTGCACTCGCGGGTGTCCGTGTACCGGA
TGCAcagcggagaaggagcaggacgTGCAGAAATACAAGCGCTATCTTCTGGATACGCTGCGCCGTAGCGGGCACGGCTTAATGACCACGGTGAGGGACG
ACCGTGCTACTACATCTTCTGCTACGACTGCTGTATCTACTCCGACCTCAGAGGGCCGATTGACCTATGGCAGTGCTCCCAATGTGGGTGATAGCAATGG
CCGCCGCTACGTCCAGTACCCACCCATTCCACCGGCAGAAGGGCGTCCTCCTATTCAACGTGGTCAAGGATTCACAATTCGCGGTGCAGAGGCTAAAGAA
ACACATGAAGAACGCAGGCAAACACAAACTCAGCCGACCGAATATGAAGCGGATGAACGGAGTAGTCGCGATGGTTATGCTCCTAGCATGCAGACACAGT
CAAAGCCTCCGTCTCACTACGCTGCCGTTCCGAAGCGCGCAGCAAAGGATACACCTGCCGATATGATCTCTGTAATGGCTGATAGTGCTATTGACcctcg
cgttgctgctggagctgcttcgtctcaTGCTCACCAAGGCTCCGTCGAGTCTCCATCGGCGGCAACTGTCATTAACTGCGTCGAGTCAGAGAAATCTCTG
GTCCAGTTGCTGAGCTCGTTGAATCAAGGTGAAAAACCTGCgacctccaccagcagccaaTCGAGCAAGGGCAGTAGTTATCTCCAAGGTGAATCACGTC
CGATTTCGAATGGAATTGCACCGAGAAGCGACAATACGCAAGGTTCTAGTGATGTCGATATGGAAGCAGCCCATCGGACTTACTCTGATGTTGGTGACCA
GCGAAACCAAACTGGTAGCCCATACCAAAAGCAATCGCCCACTAGCTCGATCGCTTCGGATGATAGTCCGCGGCGTCCAAGTGTTGGTGCACGGCTTGTC
GAGGAGTACCCGGCGCAGACGGCTAGTGAAAGTGAGACAGAGGAACGTCCCGCGCAACGCGACTCGGACGATATGTCGTCACGAGATGATGCCGATACTG
TAAGGCATACCGAAGGCGCCGCGAGAGAAGAGGCTAATGAGGTGAAGCAAGACCATTCCCATGGAAGCCCAATGCTTAGCGTGAAGGCCGATACCCGTAA
GATGGAGAACGTTCCCAAGGCTGAGATAACGGGAAACCGtgctgtgctggatctggcaCCATCCCTACCGCCTCCACCACTGCATCGTGGACCAGGGCGT
CCTCGCAAGCATCCCCTTCCTGAGGGGTACATACCGCCAAGGAGTAGCCAGCCAAAACCCAGCGCACCTATGAAAAGGGGAAGAGGTAGACCCCCGAAAC
ACCCTAAACGAATGAgtgaagaggatgacgagacggaggaagaggcttACCGTGcggaagacgatgaggaagatgaagacgaagatgaacgagatggacg
agatgcTTCGGACAGTGAGCTGGACACGAATTTAGATTTCTGTGAGGTGTGTCAGGGCGCCGGCGATCTGGTTTGCTGTGACAAATGCCCGCGTTCCTTC
CACTTAAAGTGCTTGCATATGACGGAGAACGACCTGCCTGAAGGTGACTGGCAGTGCAAGGAATGCAAAAAGCCGTCCCGGTTCGATGCGTATTCTACGG
CGGTGGCTTCCGAGCAGAGCCTGCTAGACAAGTGCCTGAAAATTGTCGAGTGCTTGAAGTCGCATCCGTTTTCAAAGCCGTTCCTGACACCGGTGGAAAA
TGTTCCTTTGTACACCAAGGTGGTCAAGCAACCGATGGATCTGTCGAGGATCGAGACTaagctgaagaagggcgCGTATATCGTGGACAGCAACACCGTG
GCGTCTGGCGTGAAGGAGTTGGATTTCACGCACTTTGCCAACGACATTCGCCTCATGTGGTCGAACTGCAAGATTTTCAATGACGACGGGTCGGGTATCA
CGCGTGCGGCGGACATCCTGTCGGCAGGCTTCGAACGCTTGTATAAAGAGTCTATTGAGCCGCCATTGACCTTGAGCTAGCGAGCTACTTCCACTGAGTG
GGTCGAGTGGTTGAGTTGGCCATCTGCGGCGTTGGGGTCTAGGAAGGTGCTTGTAAAATCAAGACGATAAGTATGAGTGCATGCCGTCAGCTATTATTGG
GGTGTTCTGTGCGTCGTTTCTAAGTAAAGCCATGTAGTTGCCAGGGACTTGAGAACTAACCGCATTCACAACAGTCTTCAGACGTTGTGGTCGTGATGGA
GCTCGCCTtggatgaagaaggtgctcaGGTGACGGCAGTGACTTCGTATGACCCGAGCTTCCCGCCGGTTAACATCTTGGACGGGTAAATATGAACGAAT
TGTGAGCTTACAAGCTTCAGTTCATTTACTCTTCTTTCATGTTTGTTGATTGAGCAGGGAACAATCGTCCAAATGGGTGACAACTGGAAGCTTTCCCCAA
GAAATCGTGGTTCAATtggcgacgacggcgtctGTCGTTCGTACCAAGATGTGGACGCGAAATGTGAAAGAGGTGGCGATTGAATCGTGCAGTGGCCCGA
CACCTACAAAATGGGAGAAACTGTTCGACACGAGTTAGTAGTACAGATTAAATTGTTTGACCTTGTCGTCACCGTACTAACCACCGCGTATCCTTTGGCC
AGAGTTGAAGGAGACCGACGGAGAGATGCAAATCGTTAGCGAGAACGTCAAGCCGACGGATGCGTCCTTCCTCAAGTTCAAGATCCTCTCTGGCTGGGAC
GACTTCGTGATAGTGCATCGTGTCAGCGTGGAAGGCTCCACGTCACGACGATAG