Transcript Name :
Phymu_g7
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_566381
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding5.3PR00056
Heat shock factor (HSF)-type, DNA-binding5.3PR00056
Heat shock factor (HSF)-type, DNA-binding5.3PR00056
*** None ***
HmmSmart predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding5.4SM00415
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-551
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
transcription factor activity, sequence-specific DNA bindingGO:0003700IEA
nucleusGO:0005634IEA
regulation of transcription, DNA-templatedGO:0006355IEA
KO ID
K09414
K09414
*** None ***
Sequence
        2084 bases(100 bases per row)
ATGGCCAAGCGCATTCGAGTAACGAAGCAAGAATCTCCCGCGGGCCTCATGGACCCATCTCCAGCCCCAGCTCCACCTAATGCTGTAGCCAAAAGCAAAG
CAGCGACACCTACCCACGCAGAGGGGAAGCACGTGATGCTGCCTGCGTTTCTATCCAAGACGTACGAAATCTTCAGCATGCCCGAGTTCTCACACGTGTG
CGGCTGGAACGCCAACGGAGACACGATCATCGtgtcgcagctggaggccTTCGTGGCCATGGTGCTGCCTCGCTTCTTTAAGCACCGCAACTTCCCGTCT
TTCGTGCGCCAGCTCAACCTCTACGGCTTCCACAAGACGGTGCTGGACTCGAAGCGGCTTGAGTTCCAGCACCCGTACTTCAAGCGTGGCCGCCCAGACC
TGTTGCACCACATTAAGCGCAAGGTCTcgaacagcaacaaccacagccagcagctcgtcagcTCCGCCCAGGTGGGTTTATACAGTAGAAACTGGGTTGA
GAAACGTTTTTGTGCTTACGATTTGATTTGTGTACAGAACTCGCGTCTTGACGCCCACCGTGAGATCTCGGACACGCTGCTAAgagagatgaaggagctc
cgCCAACGCAGTGATGCTATGGAGAAGCGTCTACGTGAAGTGGAAATTGACAATGCGGTACGAGGAAATTGATATGCCGCTTTTATTTGGCCGCTTATGA
ATGACAAGTATTTGTTTGGTAACAGATCGTCCGGAGTGATAACCTGAAGCTATGgaagcacttggagcagGCGAAGGACAAGCAGTTGAtgatgcaggag
aagatgaagaagatcatgtGGATCCTGTTCCAGATCTACCGTGGAAAGCAACAGAATCTTCCCAAACTCTCGAGCAATGACGGAGGAGCGGTTGTCACAG
AAGAGTAAGTGTCGAAGAATTTGCGCTTTTCTACGGAATCCTTGATGTATGACTAACCAATTATGCTGCTGTGTGTTTTTTTGCGATTCGTGCCTGCTTT
TTGCTCGCTTCGATTTTTGTTACTTGACGTATTGGTAGCTTTGGTGCCAACAGTATGCTTGGACCGAAGGAATTCCGTGATGTGCTTCGATTCTTGGCCA
TGGATGAACCTCAATTGTTGCCCGGGTCAACTGCGAATGTAGCTACTGCCGCGCCTGGATCCAGAAAGCGGAAGTTTGTCGAGGTACCGTCCGATGTCAG
TGAAATGCTCACAGCTGAAGAGCATCCTTACAAACTAGGTAAGTTTGTGCATGCGGATATTTACTTTAAAGTTCTTTGATTTAACGTGTTTCTGTGCCGC
TAGAAGTAGAGCCGTCGTCTGTTGTTGAAGTCCCCAGTGCAGTGGAAGATCGTAACCCCTTTGCGATGACTGTGCCGTCGAACTTGGTACACCCTGATGG
TGGACAGAACAATGTGCTCAGCATTTTTTCGCCGATCAATGCAGTGAACAACAGCGCTCCCAGCATAGATCAGACGCTAGCTGGATTCCTTACGAATGGT
GTGGCCACGACTTCTGATGATTCTGCGCCGGCCGTCTTAACACCGTCTGTATCGACATCTCCAGTATCGTCCCCAACTGTATCACTGCCGACCGCACCCA
CACCGATTGTATCCTCCCCGATATTAAAACCGAACGTGGGTACTCCGGCTGAAAGCATTGGGAATCAGACACCAAGCAAGAGCACAAACGCTTCGAATGG
CACTCCGGCTCAAGCGTCAGCAGACAACCAGCTCGCATTTTTGGACGATGAGCTTCCTCTACTGCCCGATTCAGACCATTACAACTTCACTGACGGCGAG
CAGGTACTGTAACGCATCCTGTGGCCTTTTATCATAATGCGTGCTTCTCGTTGTGGATAGTGGTTTAATGGCGTGTCTTTTGTTCGGCTGTGCATTAGCA
GGCAGTAATGAAGAAACTTGAAGATTTTGAGACGTCGCTGCTTGACGAGTACGATGTCAGTTGCCTGGACAcgctgcttcagcaactGAAAAACTCGAAC
GGGGACAAACCAGCGGGTGTTGCGGTGGCAGACCCGGAAGAGGTCGTGGTTGGTCCAACCAACGCGTCGACACACGATGCGTAA