Transcript Name :
Phymu_g44
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_532549
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
F-box domain9.127PS50181
WD40 repeat12.113PS50082
WD40-repeat-containing domain53.679PS50294
WD40 repeat12.981PS50082
WD40 repeat12.179PS50082
WD40 repeat8.737PS50082
WD40 repeat13.015PS50082
WD40 repeat13.817PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat0.055SM00320
WD40 repeat2SM00320
WD40 repeat4.8SM00320
WD40 repeat200SM00320
WD40 repeat3.5SM00320
WD40 repeat160SM00320
WD40 repeat2.4SM00320
WD40 repeat7SM00320
WD40 repeat1.3SM00320
WD40 repeat4.5SM00320
WD40 repeat2.7SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-903
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3227 bases(100 bases per row)
ATGGGGCTGTGCGAGTTGCCTAGCGACCTGTTGGCGGCAACGCTACAGTTCTCAGACCACGCGAGTCTGCTGCGTCTAGAGACCACTAACCGCCATATAC
GCGACACCATCGTCCATTGCGGTGCGTCCCTGCCCTTCGTGTCCTCCGCTTTTTCATCTGATTCCTCTCTTTCTCCTAAGGCTCGTGGCGGATCCTGGCG
CAGCATGCCGCTCTATATGCGAACTCCAGACTTAGCCGCAGCTCTGCTGACTGGAAACGTCTAGCGATGTTAGCTCACAGTCCTGTGGGCGAGGAACTCT
CCATGCTACGTCAAGTCCGAGGTCGATAGAAGACAAATGCCGAGCATTTTATTCATTTTCTAATTTTTCTTTTATTGCAGAGTGCTCGTCAGTGGATCAC
ACGAACGAGTCGGCAGAGAACACATTGACCAGGTCGCACTGTGGCATTGGCGTGGCGTTACTGACCAATACAGTGGTGGCAGACGACCCGCTTGCCTTCG
AGGCCATCGCcaagaggctgcagcaggaatgCGGCTGTGCTAGAGGACGACCTTGCTATTGGAGCAGGTACGaaaggtgctgaagaaggatTTCTTAAAA
GAGATATTGACGATTGTTTTAAACTGCAGTGCCTCGACTTGGGGGCATTCAACGACGGATTATCTGGACTACAATTTGTTGGAGAACTGCCTCGTAAACA
GCGTCCAGGTTGTGCCCTACCGGGTCTTCTGGTATCCCGGTAGCCCCACGTACTCTCCAAAGAGAGTATCCTTTGCGCTATACGAGCTTGGGGATGATGG
AGAAACCGGAATGCTCGTCTACGAGTCGATGGAATTCAGTATTGCCAAGGATATGAAGGTGCCAAGGCTTGATTTGCCTACAAGATCTTAGCTGCAGCCA
AACTGACGTGTGATGCTTTGCTGTCTTTGCGTGATTAGATGCAGACATTCGAGCTCCCGTGTCGGATTTTTCTATCTCGAGGCGTGTTGAGGTTGAATTT
GTTCGAGCGACAGGAAGATATCGGCGTTGATGTAGCCCGGTggatggaggagaacaaTCTTCCTCCGTACTATACGTGTTTGAGCTATGTAGGCGTCACG
GGGCTTCTTGAGTCTGGGGGCAGCCCATGAGTTGGTAGGTAACTTGGGGGTAAAGTTATATGTTTAGTAGTAGTGGTTTCGTTTCCTCTGTCCGTCGCTG
TTGTGGCCCCTTCAGATCACCAAGAAGCCGCTAGTGATCCTGCGCTATCGACAATGCAGTACGACGGTGGCAACAATGCACGTGGTTATGAAGACTTTCC
GGTCATAGACGGCAAGCCCAAGTCGAGAGGATTCGCTGCAACGTCGAGTTCCCCGCATCAACAATTCGACAAGCAACCGCAGCCCACCACTGTGATTGAA
CTGGAGCACACCATTGGATTCTCTGCAGTATCAAACGCCATCCATTATCATCCGTCCGGGCGAGAGTACGTGTATCCTGCGGGCGGATCCGTGCTGCTTA
CTTCGTTTCAGGACGCACACAGTCAGCTTTTCCTGCGAGGCCATGAGGGCAATGTATCATGCATCGCCATGTCACCTACTGGAAGGATGCTAGCGTCAGG
CGAGCGCGGCAGGCATGCAGATGTCCTCGTGTGGGAGTATCCCGCTCGAAGGCTCGCTTTTCGACTGTCCGAACATGACGCAGGcattgctgctcttgca
TTTTCGGATGACGAACGACTGTTATGCTCCGTGGGGGTGCCTGAAGACGGACCAAGGCTGTACATTTGGGACATTCTGACGGGCAATATCTGTGCCACAC
ACCAGAAGATGGCAAATATTGTCACTGCGGTTGCATTCGGAGGGATGGCGCGTGACGTAAAGCGCCGAGACACGGCCAACTACCAGTTTGCAACAGTTGG
GCATCGATTGCTGCAGGTTTGGGTCCTCAATCCAACCGCTGGAGAGCTCACGCAGCACAAGATCGAGCAGACACTCATTCGCGATTACACTTGCGTGCAG
TTTTCCCCCGACCGGGAGTTTCTGGTGGCTGGTAGTTCGAGTGGTGATTTCTGCGTCGTCAACGTCAAGACCCGACAGCTATTCAAGGTGGTTCCAGCGT
GTTCCTGCGGCGTCAACTCGATTTTGTACTACAATGGTGGCGTTCTGGTGGGTGGCGGCGATGGAAGCGTCCTGCACTACGGACACGACTTCGTTGATAC
TTGCCATGTTGACCTCGACAGCGGCGTTGTTGGTTTGACCCTCAATGCAGCTCAGAATGAGGCCGTCGCTGGCACGCAAGCTGGGGGTATCTTCTCCGTG
CGTCTGAATTTTGGCACGTCGCAACACACTATGAAGGCGATTTTGCTGTCCGAAAACCACTCGAACGCTGTCGTGCAGGTAGCCTACGCCCCGGACGCGT
CGGATCGATTCGCTACCATCTCACGGGACTGCACAATTCGCATTTGGGACGCCTCGGATTACACCGTTGCGACTCGCTGCTTCGttggcgatgctggtgc
cCCGACATCTCTCCAATATTCGCTGGACGTGCTTATTTCTGGGTGGACTGACGGGTGTGTTCGCTCTCATAGCAGCGATTCTGGCGAGTTGGCCTGGTCC
ATTGATAACGCCCACACTGGTGGGGTCACGGCACTTGCTCTGAGCCATAACCAGCGCTTCATAGTGTctgccggagctggagggGAAGTGCGTGTGTGGG
ATATTCGCAAACGTGACTTGGTTTCGCATCTGAAGGAGCACTCGATGGCAGTCACGAGTCTGGCTCTGTATCGTGACGACCTGCACGTGATTTCTTGCAG
TCGAGACCGAAGTCTACTGTGTTGGGATTTACGCAGTGAGCGCAGAATTTCGAGTCATATCCAGCGCATGGGCGGGATCAACACCGTGGCGCTGTCTTCA
GACCAGCGTCTTGTTCTGAGCGCTGGTCAGGAGAAACGCATATCGTATTGGGATCTGCGCATTGACACTCCAGTAACTGTGATCCTGAAGGCccacgagg
aagaagccacgTGCATTGCTGTAGCGCACAATTTCGAGGTATTCGCCACTGGTGGAAACGACAGACTCGTAAAACTCTGGAACTACAACACCAACCAGCT
AATCATGGACGGCGTTGGTCACTCTGGAAATGTACGTGGCCTAGCTTTCAGCCCGGATGATCGACAGCTAATCTCGGTGGGCGACGACGGCTGCGTATTC
GTCTGGAACCTGTACATGGAGCAGTAG