Transcript Name :
Phymu_g15
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_307593
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Tetrahydrofolate dehydrogenase/cyclohydrolase6.6PR00085
Tetrahydrofolate dehydrogenase/cyclohydrolase6.6PR00085
Tetrahydrofolate dehydrogenase/cyclohydrolase6.6PR00085
Tetrahydrofolate dehydrogenase/cyclohydrolase6.6PR00085
Tetrahydrofolate dehydrogenase/cyclohydrolase6.6PR00085
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-314
NN-scoreoddsWeighted Score
0.6151.5630.003
*** None ***
TypeScore
cytoplasmic435
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
folic acid-containing compound biosynthetic processGO:0009396IEA
KO ID
K01491
K01491
K01491
*** None ***
Sequence
        945 bases(100 bases per row)
ATGCCAGCGACCGCTACGACGCCTTTAATACTGGACGGTAAGGCCACGAGCGATGCGATCCTcacgcagcagttgcagcctCAATGTGCAGCCTTTCAAG
AGCGCTACGGCCGGTTAGTGGGCTtggccgtcgtcgtcgtgggcTCCCGCAAAGACTCGGCCACGTACGTGCgcatgaagcagaaggcgtGTACGGCCGC
GGGTATTGAGTCCTGGAAGATCCAGCTGTCATGGGACGATaatgacgacgagaagaaggtgacgagcGAGCTGTTGGCTACGATCAAACAGCTCAACGAG
CGggaggacgtggacggcaTCATTGTACAGCTCCCACTGCCGTCTTTctgcgacgaagacgctaTTCTTGCCACTATTGACCCGACGAAGGATGTGGACG
GTTTGCACCCCGAGAACCACGCCaagctgttccagttcgCTACCAAAAAGGCGACCTCgcagcatgaagaagcgccgtTCGCGCTTCCCTGCACACCTGC
CGGCTgtcttgcgctgctggaccacTACAAGATCTCGTTGGAGGGGAAGCATGTTGTGGTGCTTGGACGCAGCCAGATCGTTGGTCTACCTGTGTCGTTG
TTGTGTCTGCAGCGCAATGCTACGGTCACAATGTGCCATTCGCGTACCCAAGACCTCAAGGCGCGTGTGCTTGAGGCCGATATCGTCATTGCAGCCATTG
GACGCCCGCATTTCGTGCAAGGGAACTGGCTCAAGGCCGGCGCGACGGTCATTGATGTCGGAATTAATCCACTGGAGGacgcgacgaagaagagcgggTA
CCGTCTAGTTGGTGATGTGGATTTCGAGGCGGCTGTGAAGATTGTGCACGCTATTACGCCGGTGCCGGGCGGTGTGGGCCCAATGACTGTGGCTATGCTG
CTGAAGAATACCATTCAGTGTGCAACGCGACGTGTGCAAGAGTAA