Transcript Name :
Phymu_g17
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DNA ligase, ATP-dependent, central41.236PS50160
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-934
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
DNA ligase (ATP) activityGO:0003910IEA
DNA recombinationGO:0006310IEA
DNA repairGO:0006281IEA
KO ID
K10747
K10747
K10747
K10747
*** None ***
Sequence
        3099 bases(100 bases per row)
ATGGGGAGGAAAACGGTGCCCAAGCAGAGCACCATCGAGTACGTCGAGTCTCCAAGCTTAACCGCGTCTGTGTCTAACGCTCTTCTCTGCCGCTTGCCAG
gtcgttcttcagcacgaagccgcccaagaagcggaaaCCTGCAGAAGATGATAAGGAGACCACGGAGCCTGTGAAGAAGGCTAAAGTGGAGGAAAAAGTa
gaggaagtcgaagagaaggaacctaaaatggagaaggaacagaaggagattgaagaggacaaggaagagcaggtggaggaggagccagAGGATGTTGAta
tggaggaggaggaagaagatgcccaGAGCAGGACGAAGCGTACGCTTGCCATCATATTACTAGTTGACCTTACGACGGCTGATAATGTTGTGTGTCCTGT
TCTGTAGCTGGCCGTCGTCGACTGCGCCAACGCGTCgtggaagaggacgacgaggacagCGATTTGGATCTTCCcatgagcaagaaggaggaggtgatTG
ACATTACATCACCAGCGTCAACTCCTGAGAAGGTCAAGagccccaagaagaagactgcAACGCCGATAAAGGTGATCAAGAGCCCAAAGAAGCAGGCAAA
GAAAAGTTCTAGTCCCAAaaaagagaaggaagaaTCTGAAGAAGAGAGGGTTGAGGATGTTGAAGAAGTTACACCTAAAAAGAGTAAGACGCAGGCTAAG
AAAGggatgaagacggaggcgaagaaggagattaagacgaagacggagattaagaagacggagacgaagaaggagactgTGGCTCCTGCTGGACCCAAGA
CGGGCTTCTTCTCTCCAGTctcgagcaagaagaacaagactAAGTCAACGCCACCCGACGAGAAAAAGGAAATCAAAACCAAAAATGAATCGGAGTCGAA
ACAAGCGGCTGAGAAGCAGGAGGATGGCGACGAACCTAAGGAGATCCCGTATTTCGATCTGGCTCATTTGTTCGCCAAGATCGAAGAGGTTACTGGTCGT
CTCGTAATTCAGGACTTGCTGACGGCATTCTTTCGTGATGTCATTCGTCGTTCACCGGACGATCTGCTGGCCTGCGTCTACCTTTGTGTGTGTGTCGACC
TTGCTCCGCCGTTCGAGAACCTGAAGATTGGTATTGGTGACGCTATTCTGATGAAAGCCATCGGTGAGGCAACAGGAGCAAACCTTAAGTTCATCAAGGA
GATGTACCACAAGGAAGGTGATCTCGGCAAGGTTGCGCAGAACGCCCGATCAAAACAGAAGACGCTTTCGTTCGCGTCTCTTAAACCTGCAACTTCTAAG
GGCAATGGACTCACCGTGCAGCAAGTGTACAACCAGTTCGTTAAGATTGCCAAGATGACCGGAAACaactcgcagcagcagaagtgcTCCATCATCAAGG
GTTTGCTGGTGAAGTgcgagaaggaaaagaaaaacaaagGTGCTCTGTCTGCCGAAGGAGCCAAGTATATTATTCGCGGGCTTCAAGGTAAGCTTCGAAT
TGGGCTGGCCGAAAAGTCGATCCTGATGGGATTGACCTACGCGTTTATGACGGATAAGGAGtacaaggacaaggacaaaCAGCAGGAGGCACTCGCCTTT
GTCAAGAAGGCGTTTGCTGAATGCCCCAGCTACAACGCACTGATAGCAGCATTTTATGAAGTCCAGAAGGAGGTTTCAACTGCTCCTTTCCTCCTCGTGA
AGGATTTCGCGAAGGTAGCTGAGAAATGTGTGCTGACACCTGGCACACCAGTGTCTCCTATGCTCGCTCGTCCGACGAAGGCGTACGCGATGGTGTTCGA
CCGCTTCGAAGGCAAGCCGTTCACGTGCGAATACAAATACGATGGCGAACGCGCTCAGATCCACATTCTTCCAAACGGAGAAATTGCTATTTTCTCTCGC
AATTTCGAGAACTCTACTGAGCGATTCCCCGATGTTAAGCTTGCCATCTCggaagctgccaagaaggGCGTTGTCGAAAGCTGTATCGTTGATGCGGAGG
TGGTTGCTGTTGATCGTGCGACTAACAAGCGCCTGCCATTCCAGATTCTGAGCACGCGCTCTAGAAAGGTACGTTGCAAGAAAACTTGACATTATTTCAT
CCTGGTGCTAGCCTCTCACCGTGCTTGTGGTCATTGCCCTGTGGTCATTACAGAATGTGAAAGTGGAAGATATCAAGGTTCCTGTATGTATCTATGCCTT
TGACCTGCTATTCCTTAATGGTGAGTCATTCCTCAGTACTCCACTAGCGAAGCGTCGTGAAAAACTGCGCGAGATGTTCAAAGTGATGCCCGGAAACTTC
GAGTTCGCTACATCGTTGGATGTTGAGGATGGCGTTGATGTGAAGGACAACCCTGAGGCTatggaagaagctgtggacAAGGTTCGTAATTTCCTCGAAG
AGGCCGTACGCGAAAACTGTGAAGGTTTGATGGTGAAAACCCTCGAAAAGGAGGCGACATATGAGCCAGCCAACCGATCCCACAAatggctgaagctgaa
gaaggatTACCTGGATGGCATTGGAGATTCTGCAGACCTGGTTCCGATCGGCGCATTCCACGGCCGTGGCAAACGCACTGGTGTGTATGGAGCCTATTTG
CTGGCATGTTACGACCCGGACACGGAGATGTACCAACCCATTACGAAGCTCGGTACTGGTTTGTCCGATGAAGTGCTGAAGCAATTCTACGAccagctca
aggagaaggtcgTAGACAAACCGCCAAGTGACTATGCAGTCGGCGAAGGAATCAAGCCAGACGTTTGGTTTGAGGCGAGCTGTGTGTGGGAGATTCTAGG
CGCTGACCTTTCGATCTCGCCGAAGTACACAGCAGCCATCGGCCTTgtggccaaggacaagggCATTTCGCTCCGTTTCCCTCGGTTCATTCGCATTCGT
GATGACAAGGAGACGACACAGGCGACAAACTCTGCTCAGGTACGAAAGAACTGGTGTTGTACTACTTATTTGACAAAATATTGGCTCACTAAATTGTGAT
ATTTCTTGGTGATCACAGATCGCCGATTTGTATCGAGCACAGGGCCTCACCACGGTAACCAACggcgacgaggaagaggacgacgacatgttGATCTAG