Transcript Name :
Phymu_g14
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5440.72717
InsideOutsideTMhelix
1-31
87-115
170-175
50-63
136-149
199-218
32-49
64-86
116-135
150-169
176-198
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        657 bases(100 bases per row)
atgctACTGGAGATCGGACGCTTTGTCTTCCTGGCGCTGACGGACGCCGCGATGCTGCCGGCGCTGGACGTCATGAAGCGCAACCGCCGCCAtttcgagc
tgttcgtgggagtgttgcagctcttggtggCCTTTAGCTTCAATGCCGCGGAGGCTTTCGACACGCAGCTGTTCCTTAAAGAGGACGAGTGGCACTTTAT
CTCGGACGTTTTGTCCATCTCGtacttcctgctgctctgcgtGCATCTCATGGGCTACAAGGACGAGAACCACAACATTGTGTTGCGTTATGTGGCCTTT
GCGGGTGCTTGGCTCTTTAAAACCAAGGACGGATGGGACTCCACGCTCTACGAAGGGCTACTGGTCGTTTGTTACCTGCTCGGCGTCGTCTACCGTCGTG
TCTTCACTCCAACAAACGAAATTTCCCCATTGAACAAGCAAAACGCTACGTACGCTGTCGGTTGCCTTGGTGTCGCGACTATCGTCGGGTTTATTGCGAT
TTtcttcgaggaggacgagaacaacaCAGCACTCGGATTCGCCAAAGGCTTGATGCACATGCTGGGCGGTGCTGCGTTCTACTACGCGTGGCTGTCGGTG
CCTTGCATGGAttccaagaaggacgacatCATCCCAACTCACAGCTCGTTCGTGTAG