Transcript Name :
Phymu_g18
Orientation:
(+)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-310
NN-scoreoddsWeighted Score
0.9216.2070.012
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
*** None ***
Sequence
        995 bases(100 bases per row)
ATGGGCCGCAAGCAGATGGCTCTGGTGCCTTCGGGCCTGCCTTCATCGAACTTGGGGCGCTTTCACTCGGACGCAACTGATGCCCCTTTCCTCTCTGTCG
TGTCGTGGACCTGTCGCTCCAGTGCGGAGTCCTCACGAACGCGGCAATTGGCTCTGGACAAGGACAAACAGCAACTATTGGAACTACAGCGACTTCAGCC
CGACGAAGGCGCGCGCAGCTGGTTTGTGGGTAACTGCGTGCTTCAAGATGgaggagtgatggtcttctCCCCTATCGATGcgctgttcgtgctgctggac
gctgcGTGGCCTCAGCGCACGCGCTTCTCGTCGGTCTACGATCTGCTGGCTGGGGACCAGAAcacgtggctgctgcagctctcgacgCTCACtcaggaga
agatcgagacCATTTTCGACGTGCAGGCGGTCGGAGGGGAGGAAGGAGTGGACAATCTCTACGTTAAGGCCAGCGAGGACAAGGTTACGCGCTGGCTGAG
GACAAAAGTAGAGAAAGTGGCGAATGTGCTAGCGCAGCAGGAGATTCAAGCTTCGAGGAAGGCTGCGGTGGATGAACAAGTGACGCTACCGGGTGTTAAA
CCGACAgagcggaagagcagcgaagTGACGGAGGGAGATGTGGCCAGACATTATCGAGAGGCTATTACTATTGTAGGGAATTATCTGTCGGACGAGTGGG
TCGACCTGCTGTGCATCGAGTTCCAGTAAGTTCTGTTCTAAAGTATTTGTAGATGAGGTGCTGACGAATGCTTGTTGTGCCTTTTagagtgaagaaggag
gtggaagtTGTCAAGGCAGCTAAAGCGGCTGCACCACTGGATACGTTCAAGCGGTTTGACCGTCGACAGGCACCTGAAAACAACAGCAAGAGACCGACGC
CATCTGCTGCGGGTGCTGCGAAAAAGAAGAGCAAACTAGCCAATGTGGATCGCTCAGGCATGAAGTCTCTCACGTCGTTCTTTGGCAAGAAGTAG