Transcript Name :
Phymu_g43
Orientation:
(+)
Number of Exons:
3
Description :
cytosol aminopeptidase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Leucine aminopeptidase/peptidase B2.9PR00481
Leucine aminopeptidase/peptidase B2.9PR00481
Leucine aminopeptidase/peptidase B2.9PR00481
Leucine aminopeptidase/peptidase B2.9PR00481
Leucine aminopeptidase/peptidase B2.9PR00481
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-522
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
aminopeptidase activityGO:0004177IEA
metalloexopeptidase activityGO:0008235IEA
cytoplasmGO:0005737IEA
protein metabolic processGO:0019538IEA
KO ID
K01255
*** None ***
Sequence
        1697 bases(100 bases per row)
ATGCTCAgtcgcttcttcagctcttcatcgtcctcggCCGCGCACCGTatggtgcagcagcgcgtccaaGGCCAAGTGTCGCTGCTTTCCAAGGAGCTGT
CAGCACCTACTACGCGCGTTGTGTTTGTGCCGCGTTCGACTGCTTCGGATCTGCAGTCTTCGCTCCCGTTCCCCGTGTCTGCCGCCGCTCTACGCGACTT
CAAGGCCAAGccgcaggagaagctctaTCTGTACCCGAGTGTGGACGATGAGGCCGTTAAGGACCAGCGTGTGCTGCTCGTGGGGTTGGGGGATGCGGCT
AAGGTGACGCCTAATGTGCTACGTGACGCTACGCACGGAGCGCTGAGCGCACTCAAGGCCAAACGCGCcaaggacgtggtggtgcaggTGCCTAACCTTG
AAGGGTGCAAGGTGGATGCCTCCCGCGTGGTGGAGCTACTGTCCCAAGCGTCCATGCTGTCCAATTACCAGTTCGACCAGTACCTGACAGACTCCGAAGA
CGCTTACGGAGACCGCAAACTACGTGTTCCCCTTGAAAAGATCTATTTGGATGCATCAGCAGAGTTCCAAAAGGTAAGAGAGCGTGGTGGTCGAAAAGTG
ATAGCGGAGACTGATGCGCGCTTGCTGTAGAATGTGGACGAACAAGCGACGGTGGGCGAAGAAACGATTTTTGCACGCAACCTTGGTTGGTAGCTGTAGT
AGCACTATGACGACAACTTCTAGTTGGGTACTAACTGTGTCTTTGTTGGTGCGCAGGCAACGAACGCTCGCACATTGCGAACCCAGCCTTTatggaggag
gtggcacGCGCGTCCGCCGACCTTCCCAACATGTCGGTTcgggtgctgcagcaagaagacctggagaaggagggTATGAACATGTTCTTGAGTGTCGGCC
AGGCTGGAGTGTGCCCTCCTCGTCTTGTGATTCTTGAGTACCGTGGCAACCCggactcggacgagaaggtcgCGCTGGTCGGTAAGGGTATCACATTTGA
CACAGGCGGCTTGAACCTCAAGCCGACAGGCTCCATCGAAGACATGCACACGGACATGTGCGGTTCTGCCGCCGTGCTTGGTGCTGTTCGTGCCGCTTCC
CGCCAGGGCCTTAAAGCAAACATTGTCTGTGCCCTTGCCCTGGCTGAGAACGCGATCGGATCCAAGGCCGTGAAGCCGCTGACGATTGTCCAGTCGCACA
AGGGCATCACGGTGGAAAACAACAACACGGACGCTGAGGGCCGCCTGGTGCTTGGTGACGCGATGTCGTACGTCCAGAAGGAGTACAAGCCCAAGAAGGT
CATCGACGTGGCTACCCTTACTGGTGCGTGTATGATCGCTCTGGGAGAACACTGCGCTGGCCTGTTCTCGAACTCGGACGAGTTTGCCAAGAAACTGCAG
GAGTCTGGAACGGAGTGCCACGAGCGCTGCTGGCATCTGCCGATTCTCCCCGAGCACACTGCGGCTCTCAAGGGCTCGCAGTCGGACTCTCGCAGCACTG
GTCGCGGTCGCTATGGCGGCGCGTCcacggctgcagctttcctgcagcagtttgtgTATGAGGGTGTGGACTGGGCCCATATCGACATCGCAGGGCCCTC
GAACTACAGTGCTGCGAAGTCATATTTCCCTAAGGGTGCCACGGGCTTTGGCGTCCAATTGCTCTACACCTACCTGAaggagcacgagcagcatTAG