Transcript Name :
Phymu_g1
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_533104
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Leucine-rich repeat4.67PS51450
Leucine-rich repeat6.203PS51450
Leucine-rich repeat8.613PS51450
Leucine-rich repeat7.003PS51450
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-456
NN-scoreoddsWeighted Score
0.6521.8230.004
*** None ***
TypeScore
nuclear870
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1759 bases(100 bases per row)
ATGAGCTCGGTTGTGATGGATGACCTACGTCACGAAatggacgagaacgtggTGGTATCTGCTACGACAGTGAAGAGAAAACCGGGTACAGGAGGACCGA
AGCCCAGCGAGATCAAGACGAGCTTCCTGATCCGGACATTACCGAAAGAATGCAACCCGACGCCGCTTCCTTCTGGTGGATTAAGTGCGAGTGCATCCGG
ACTGCTTTCTCCGGTGATAAACAAGCTCAGCAGACAAGAAACGGAGTTAGAGATCCTACAGTTGGAGAATCCGTTTGACGACATCACacaggagaagctg
gtggggttaatgttttttttattcaTTACTTAATTATTGAGTATTTCATTCTTTTTGTATCCTTCAGAAAAAACTGACAGGAGACCAAGATCTTGAGAAA
GTCACTTCACTGCAGATATCGGTCGATTCCTCTAAACAATCCGTTGAAGGGATTGGCGAACTGTTGCCATCTCTACAACAGTTacgactgcagcagagcT
GTGTCAGTAGCTTTCGCGACTTGGGTACTTCGCTTCGCTCCTTACGCATCCTCTGGGCGATGCACTGCCAGATCTCCGAGCTTGACGGCATTGGAGCGCT
TATGAATTTACGAGAACTCTACTTACAGCACAATAACGTGAGCGATATTAGCCCATTGACGATGCACGAGGAACTACGCATCGTTGGTAAGCACAGAAAA
CGTCAATACGGATCTTGCGCTGGTGTTAATACTGTAAAAATGTTGTGGTTCCTAGATTTGGAAGGGAATCGCGTTGCTGATATCGGccaactcgagcagc
tcggtATGACTCTGTTTTTAATTTACGCGTGCACTACAGGTAGAGTTTAGTTTACTAAGTATCGTTGTTATGTGTAGCATTTTGCCCGCAGCTGATGTCG
TTGAATTTGGTTGGAAATCCTGTTGAGACTGCCGAGCATTACCGACAGATTATAGCCAACTTCGTGCCGCAACTCGGGTCCTTAGATGACAGAGCTTTCT
CCGATAGCGAACGGGCTAAACTTTCGGACGTGGAGATTGATACGGCGATTCAAAAGCACCAGGACCAACTTCAAGCCAATACTCCAGCCAGTAATTCAGC
AAGTAACATACGAGCGATTGAGACCAGCAGCCCTCGTCAGCTGTCGTACTCGTCTAGCACAGCTAGTCTCAATGGATTTCCAGCCGAATCGCCTCGTAAC
GATGACTCGGGCAGCCGCCTTACGCATGGGACAGACATCGTATTCGCAGGGAACGTTTCGAGTGCTTTACGTCGCCACCGTCACGAAGCAGAAGTCGGAG
GAACACAGGATCTTCGTATTTTGTCAGCTAGCAGTTCCGGAACGTGTACGGCTAACTCACGACCTCCGTCAAGTCATGGACTGCCTGACCGTCCGAAGAC
CCCGGCACAAAGGATTTCCATCACTGATACACTGGACCGAGCACGGGAGCTCGACACTCACAAGCACAGGTCACGCGAAGCCATCCTCGATGAGCTTAAA
ACTTGGCAGCTGGACAGTGTTGGTACATCACAGATTGGGGTCCCGCGAGAATCCGTCTACGAAGGAGATAACGCATCCAAACggacttcttctcgaagGA
AAGGCAGTATCAATGGCATCTTGAATATCGATGCTGCGTCTCTAGCTCGACTGGAGCGCAGGCCGAACACTTCCGCTGGGGTGTTACGTAATGGTATCAA
CGTCCGAGAAGCGTTTGTTGAGGCAGCTAGTGGTCCCGGTAATTGTCCACCAAGACCAA