Transcript Name :
Phymu_g10
Orientation:
(-)
Number of Exons:
4
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
CS domain12.779PS51203
SGS15.599PS51048
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
SGSIPR007699
CS domainIPR007052
*** None ***
InsideOutsideTMhelix
1-232
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K04507
*** None ***
Sequence
        905 bases(100 bases per row)
ATGGCAGACAACACGGACGCTTTGAGGGCTGAGATCGCCGAGATGCAGACGCTACTGGCGCAGACCAAGACGTCTGGCAACCGCCGCGATCTCGAGCAGC
TGttgcagcgcaagcagaaggctCTTGAGGCCtctgagctgcagcaggagaagtCAAAGGCGGCGGATACACTCAAGCCGGAACCGGTCAAGGTGGCGCC
TCGTCCTGTAGCCAACGACCGAACGGCGTTTACGGAGATCAGCCGCTTCGGCTGGGAGGACGATGGCTAcggcaaggagaaggtggcggtcTACATCATG
TCAGGCGTCGATGGCGTCGGCAATttggccaaggagaacgtGACCTGCCACTTTACCAAGACATCGTTCGACCTGAAGGTATCTGGATATTGATTCAATA
TTTAGGTTGACAGATAGTTGCTAAATACCTGTTCTTGCTGTGGCAGATTATTGGGCTGGATAACAAGAACTACAGGTGAGTCGAATAGCTGATGAAAATT
ACGAGTTGCGTTCTTACTGACTGTTAATGTTTTCAGATTGTTCAAGCAACAtttggagaaggagattgaCCCAGCAAAGAGCTCGTTCCGGGTGAAAAAG
AACCGCGTAACGATTTCGCTTTACAAAGCGGACAAGGACAGCACGTGGATGAACCTCACGGCCAAGAACCcgtcgaagagcagcaagccTGACACGAGCG
ATCCGTCTGCGGGCATCATGAACATGATGAAGGTACGTTCATTTTTAACCTTGACTTCATTGTGAAATTCTAAAAACTAACGTGGAATTCCTCATCTTCT
ACCCCGTAGAACATGTAcgatgatggcgacgacgagatgaagcgcacAATTGCCAAGGCGTGGACTGAGAGTCGCGACAAGAACGGAGCTGCCAGCCCCT
TCTAA