Transcript Name :
Phymu_g33
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_532525
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-185
NN-scoreoddsWeighted Score
0.9331.3790.003
*** None ***
TypeScore
nuclear739
GO
*** None ***
*** None ***
*** None ***
Sequence
        558 bases(100 bases per row)
ATGCGTCCGCAGAGCTCGAGTCAAGACAGCCCCAGCGCAAGCGACAACCAGCGAGATACCGACGACTACCGAGCGgaactcgagcgtctgctgcaTGTCT
ACGAGCCCGGAAATGAGGCCTCGGCCGCGCAGCTGTTGGAGACATACGCGGGCTTGGAGCACGAACTGGTCGAATGCTATCGCCAATACTACGCAGGCAA
GGGCAGCTTCcgcgtggcgctggacgacaacCAAGAGGCCGGCTCGCCGCGCGTGTCGTCCCCCGGGCCGCTGCATATACCCACGTCGGCTATCGGTACC
TATCtgcaggccaagctgcagtcgaaACGGGCCGGTGCGGCCCGCAATGCTAAGCTTGAAGATGTGCGCGGCCCTACAGCTGCTGACAGTCCCAGTAGAA
GACGCCCCGCGGCCGTTGCACCTCGTCGACGAGCCACCAGTTTCACTGCCAGACTACAgcatgaagctggtgccTTGAGCGGCtatgaagacgaggacga
ggccgcTTTGGCTCGACGAGCGTCCACGCCGACAGAGTTCAGTCGGAACAGCTCGTAG