Transcript Name :
Phyin_T30-4PITG_22171
Orientation:
(-)
Number of Exons:
1
Description :
Kazal-type serine protease inhibitor%2C putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Kazal domain7.812PS51465
Kazal domain8.567PS51465
Kazal domain11.446PS51465
HmmSmart predictionP-Valprediction_id
Kazal domain0.7SM00280
Kazal domain0.0051SM00280
Kazal domain1.2SM00280
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-271
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        816 bases(100 bases per row)
ATGAGGCCCGTGACGGACGAGAACGGAGTCACGTACTCGAACGAGTGCATGATGCGTGCAGCCAAGTGCAAGGGTAAAGGGAAACGGGAGGACCCCTTGG
AGGAGTACAAGCGTATCTACGGCAAGCCCTTCGGTGCCCCACGCGATGACGACGAAGACGAATCCGCCAGCTCGGATACAGTCACTCAGGGCGAGGACTC
GGACGAGGACGAATCAGCATCTGAAGAAGGCTCAGCTGAAGGCACCCCTAAGTCGTACTGCCCCAACATCATGTGCCCTGCCGTGTACCAACCCGTGACT
GACGAGAATGGTGTGACGTACCCCAACAAGTGTTCCATGGAGGCCGCCAAGTGCAAGGGTCCGAGAGAAAACGTTTTGGATGAATACAAGCGGATCTACG
GTAAGGAGTTTGGCGCCCCCCGTGACGATGATTCTAGAGATGACGACGACGAGTCTGCTAGCGAAGACAGCAGCAGCCCATCGCCAGCGACTAAAATGGT
GGAGGGTACGAAGGACTCTGGTAAAGCGAAGAAGTCTACTAAGTCATCGTCAACCACCTCGAGCGGCATTGGACAAATTTACGAGGACGACTCAGAAGGT
GTCATTGACGATGGCAACTCGACGCCTAGCAAGAAATGTGCGAGTGCCTGCCCTGACGTCGAATTACCTGTTTGTGGCTCCGACGGTGTCCGGTACTCGA
ACCCGTGTGAGCTCAAGATCGCTGCCTGTAAGAACCCGGAGCAGAACATCGTGGAGAAAGATGGCGCCTGCAGCTCGAAGAAAACAGGTAAGATCGGCAT
CCTGCCTGTCGTGTAA