Transcript Name :
Phyke_g11773
Orientation:
(-)
Number of Exons:
1
Description :
Crinkler (CRN) family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-624
NN-scoreoddsWeighted Score
0.5291.2850.003
*** None ***
TypeScore
cytoplasmic609
GO
*** None ***
*** None ***
*** None ***
Sequence
        1875 bases(100 bases per row)
ATGGCGCGGATGGCGTGGTTCCAACTGGTGGATTTGCGTGGCGAAGCATTCAACAACACGACTCCAGACCAAGTGCCATTGAACGATAATAACAATGTTG
CGAGCTTCCGAACAGCAGTGAAGAGACTATATGAAGACAGCCACCTCCACGGGATTGCTGCGTCCGATCTCATCGTGTATGAGAGCCAGGCGGCGTTTGC
TGCGGAACAACCGCTTGAGCTCGATGCAATGATTGAAAAGCGTGGCGGAAAACTACGGAATTCGCTCCTTGTAAAAGTGCCGAACCTCACGAGAAAGCGA
AAACTCTCCGAAGAGTCGATTCTGGATCAGTTGGAAGCACTGCAAGTTGCCGAAGTCGAGTTTCAACTGGATGCGCTCTCGGATAAGCAAGAAAGTGAGA
ATCCGATCGTGATGACACCAGGATTGCACACCTTTTGGAAAGAATCTGGTGATTTTCCGTCGTCTTACTTCGTTCGgaaggaagaagtggtgTTCTGGCA
AGTGGTGAAGGGACTGCTTCCTACTGTTGGAAAGAAGCGCATTGTGATGGTCGGCTCGCCTGGTGTTGGCAAGTCGTGCTTTCTCATGCTTGTTGGCTTC
TACATGGCATGtgtcgagaagaagaaggtgctcaTCATACGGCGCGTGAAAGAAGGTGACGTTGCAAATGCAGTGGTGTATTTTGATGGACAAGGGTCGT
TTGCTCGACAAAAAAACCTCTCTGCTTATCGCTTGCAACTCCTTCGCGAGGAAAAGAAGCTTCAGGGTGCGCTCGTTCTTGTTGATGGTTATTCGCAAGC
TTATGTCGATTCGGAAGCAAATGGACTTCTTCCATTTCATCTTCTGGCTACATCGTGTCAGTACGACGCGAAGCACGATGACCCGTCACATGTTGTGGTT
TTACCGGCGTGGCAGCGCGACGACCTAGAGCAGTACGCACGTTTGACCGAATGGGTGATCTCAACTGGATTTCGCAAGACCAAAAATTTGAAGGATTCGA
CTTGGCCCAAGCTTGTCAAAGAGCAGTACTTTTACTCTGGTGGCAGTCTGCGCGAGTTTTGCAAGACACGCGAAGCTCTCGAGGAACAAGTTGAAAAAGA
TTGTGGTAAAGTTGGCAATGCGCAGGCATACCAACTGGTTTACACGTATGGAGGTGATCGGAGCAATGATCAAGTGGATCGAGTTCGGCGCCATTACATC
ACCGATCCAAAGAACGAAGAGCACTACACAAAGTCAAGATACTGGAAGGTCTCGGTCGATTCTGGATATGCATTGAAGTTGTTGGGACGACATGTCAGca
tggagaagcagttggaAGTGTTCAAGTATGCAGAATCTATTGGTGCTGGCTTCTTAGGTACCGCATATGAGCTGTTATTGCACCATGCCGTCCATGAAGC
GTACGCAAAGAAGACTCCTGTTgtgttgaagatgaagaagggaTCGTACTACGAAAGAATCGAGATATGTGTTCCACATGTTGAATGCTGCGGCGAGAAT
GAAGATGAGTGCTACATTTGCTTGGCCAAGCTCTCTGAGAGGACTTATTGGCATCCCGATTATCCATTCTTCCCTTTCATCGATGCAGTGGTGATGTGTG
AAGCGTTTAAGAGTGGAAGCAATCGCCCAGAGATGATCGTGGCTTATATCCAGGCGACCATTCGAAACGAGAAAACCTTCAAGCCACATCGACTACGCGA
GTTGAACGAAGCGATGAATAAGAATCCGAACATCGTTGATGTCAATCGTgcgtttgtggtggtgggcCCAGACTCCACTATCTGCGAGACATTTACATTG
CGTGATGCTCCAAACCCAGAGGATTTTCTGACGATGGTGAGCTGCTTCGACCCACACGAGTTCGAGAGACAATGA