/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_12de6011e0a5ea27d7cdd6f4a4633e0a -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/890382 -w 120 -web -o /tmp/images/bd_log_output_file_12de6011e0a5ea27d7cdd6f4a4633e0a
Transcript Name :
Albla_Nc14000550
Orientation:
(-)
Number of Exons:
7
Description :
protein kinase putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain33.771PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain2SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
KO ID
K06632
Cluster Id
2779
Sequence
        2121 bases(100 bases per row)
ATGGCACCGTTGAGGACTCCTGACGCTAATGCCGGAACCGGAATGATGACACGTCTTAAAGCCAAAACAAAAGCTTGTGCGGAATCGCTCTCAATGGGCC
GAAAACAACGCTCTCTCCACGAATTCTTCAAGCGGTATTGTGCCTCTTTCTGCGTCTCTCTCATCCCCTCATCGCTCCACTGGATGCAACAGGTCCGAAG
AGAGCAAAAATGGACGCAAAACGACTCGAAAAAGAGCCCGACAAAGCACAGAAGCTCTCAGAACCGAGGACTTTGATGGAGTTGTGAAGAAGCGAATCGA
ATACGACACAACTTCAGACTCGGATGAGTCGAAAAGTGAGCGGAATGCCACCTCACAGAGCAGTGAGGACGCGCCAATGTCACCGCTTACGCCCACAAAA
ATCGATTTGGACGATATGAAAAAAGCCTCTATGAGCTCTGAGGAACCCGATAAAGAGCCATTTGCATCGAAACAGAAACAGAGAGCGCCCTCCCCGAAAT
TTTACAGTGAGGAGCGATCACAATTGTCTCCGAAAAGCACAGTTACGATACCAACACAATCGTCCTTGTCGCGATTATACAGTCAATGTGATGAAGTGGA
TTTCCTCACGCCTCAGGACCAGCCTGTGATGCATCTATCTCATCCTACAACGCCCTCACCACTCAAGAAACGCCATCGTCGAGACTATAACACGAGCGAT
TCCGAACAAGACGAAAATATGGTTGGACCGCTGAAATCGACTCCAAACTCCGGAACATTGGACAGCTGTGTGTCTGGCTTGGGGCCGCTGGTACCCGAGA
CTCCGATGGATGATCTGAAGGCTATTTGTCATGGTCCGTCCAAGAGGACGGGTCAGAGCAGTACGGTGAAGAAATCGCCAAAGTAGGTTCTTTTCTATAA
CGAGGCCTTCTCTTGCTGAGTGGAGGATCTAGGACAACTCGAGTCAATGCGGCAGCCCGAATCTTGTTAGAGCCGTTTACGAATCCGTTCACATCGCCAT
TCTCGCCTCCAGCACTATTGGAAGTGACAAAAACAGGCTCTCGAAAGCGCTCACAACGCCAACGTCAAAGCCTCCCGTTAGCTTTCGAGACCAATACGAA
GAATCTCTCGCGATATTTATGCGATTTCGTCGAGAAACAGGTCTGAAATTCGCATTTGAGAGTCTATACAACGCTCATTTTTCAATGGAAACAGCTTATA
GGCGCCGGGTCGTTCTCCAAAGTGTTTAAATGTCTGAAGAAAATGGACGGATGGATCTACGCCGTGAAGAAAAGCAAGCGTCATTTCCGTGGGAATGCAG
ACATGTTTGTGTGCATCGCTTTGGAGACAATTTTCTGACTGATTTATATCCCTCAGGCAACGATCTCTGCGTGAGGTGCAAGCCCTAGCAGCACTGAGTG
ACAGCCAGCACATTGTCCGCTACTTTGACGCGTGGATAGAGGACGACTTGCTCTACATCCAACTGGAATTCTGTCAAGGCTGCAGTCTCCAGTACTTCTT
GAATCAAGCACACGCTCAAAATCGTCCATTTGTCTCGGAACAAACACTTTGTCGCGTACTCTGTCACATCGCTAAAGCACTGTGTGACATGCACGCGCGA
AGGATGGTCCACATGGACGTAAAAGTGCAAAATTTTCTGGTCCGAATGCCCAACGAAATTTACAAAGTACGTTGCCGGGCTCTTTTCGCATACAACTCAA
GTGATTGTATGAGGTAGTTGGGTGATTTAGGCACTGTGGTGCATCAGGATGGCAACATGGAAGTCACAGAAGGAGATACGCGTTACCTGAGTCGGGAATT
ACTGGAGGGAAACCGGTCGCATCTTCGTGCTGGCGATGTGTTTGCACTTGGGGCTTCCATCTACGAACTCGAACTGGGCAAAACACTTCCATCCTGTGGC
GATGCATGGCAACAGATTCGAGACGGGGATCTCGTTATGTTCCGGTACGTTGTGTATGGGTCGCAATTTGGATCCCTGAGGCGAATTCTGGCTGATGTAG
ACACTATTCCAACTCCTTACAGCATCTCGTTGCGAATATGATGCATCCGGACCCTCTACAACGCCCATCGGCCGAAGAAATACTTCAACACGATGTGGTC
CAATCATTTTGCTGCCACTAA