Transcript Name :
Phyin_T30-4PITG_19473
Orientation:
(+)
Number of Exons:
1
Description :
Putative uncharacterized protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Armadillo37SM00185
Armadillo18SM00185
Armadillo38SM00185
Armadillo390SM00185
Armadillo24SM00185
Armadillo19SM00185
Armadillo0.16SM00185
Armadillo450SM00185
Armadillo4.6SM00185
Armadillo42SM00185
Armadillo180SM00185
Armadillo300SM00185
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1921
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        5766 bases(100 bases per row)
ATGACGATCAACCCACCAAAATGCGCAGTCAACATGGAGCAGCGACTGGCAGCACTGCGACGCGACCAGGAGATCGACGGGTTGAGGGTCTATCTTATCA
AGTACAACCTCTTCCCACGTAATCGAGATCCGCACAACTCGCCCATTCGATTGGAAGAACTAAAAGAACTCGTCAAGCACTGGAAGCTTCATCGACAACG
AGGGTTTTGGCGCGATCATCCGGATAAAGACGACCTCGTTCGCGCCTTACTGCAGCATATCAAGAGCGAGGCAGCGAACAAGAAACGACGACAGGAAGCA
CAAGACAAGTATCGCAGTAAAACAATAAGTGGAGCTGATGATGGCAGTCCTGGCAAGCATCGAGACTTCTCGACGTTCTTCGGTGGCAACGCAAACGCCC
ACTCGAGTGGAGACGAAGCCGAGAATGACGACGATGACCGAGAACAGTCTGTGGCTGTTGCCAAGAAGAAAAAATGTGGTGGCGATCTGTTCTACCAACG
CGGAGACTACGACGAAGGACTCATCTATCTGTCTCGAATCGACAGGTCTCGTTTCCAGTCTGAAAGCCACAATCCCTGCCAGGATCTGCTCACGACGTCT
GCTTCAGCACCCACTCCAGTCGACCGTCTACTCCTGACAACTCCTGACGCCAGCAGCAAGCCTAAAAGTGTTAGCGCCACATCTGCGAATGACAAAGAAG
GCGAGCGAGCAATGAACCAGATGCCGTCCGTGTTGGTGAGCCCTCTGCTCTCTGGATCCGTAAACACTGCACATTTGACCAAGGATACGAAGCTCAAGTC
TGTCGAAGGTCTCTACAGCATTTCGTACCACAAAGGCTACGAGGCTCAACTCCTGCGTGAGGGTGCACTCGCCACGTTGTCCAGCGTCCTCAAGCTAGAC
GATCCAATTATCCGTCTGTACTCTGCCGCGGCAATTTTGAACCTCACGCATTACACTCCAGCCCCACCTTCGCCCCTGCCTACTCCAGTGAAGAAGAATC
AGAGCCAGCCATCGTCATCTTGTCTATTGCCGACGGCACCTCCACAAGCGACTAGAGATTTGTACTCGAAAATGACGGACGAAGGCGTAATTGCAGCGCT
GCTGGATCTCGTACATACGCCGCATCCGACCGTCAAGGCTTTGTGCGCTCGAGCACTACTTCGCTTTACAGTTGATGAATCACACCACTTTGCTATGGTG
CATGAGGGTGTAGTGGCTGCGCTTTCACAGATTATGGCTGCAGTGACCACAACCACAGCGTCGCCTCTAGCTGCACCGAATGATGTCAAGCTCTTCTGCG
TATTAGCGCTCGTCAATCTGTCGGATGTACCGCGTGCTGTCACGTGCGACGCGCTGCTGAACTCAATTATCGTGTTGGCGCGACAGGGAGACACTGCGAC
GCGAAGAGTATGCGCTCAGGCGCTGCTGAACCTCTCGATTCTTCCGACAACTCGTGGAGTAGTGGTGGACGAAGGAGCGATCGCAGCTCTTGAAGTGCTA
ACAGCTGTGGCGATGAGGCCCTTGCAACTCTCTCAATTGGAGGTGGTCACCTGTACATTGTGCAATCTGGCGGCCGTGAAGAACAACCAGGATGCACTGA
CGAAGAACAGCGCATTGACGATCTTGTCAGATATTATCTTAAGCGTGGGGGCAGAGCTGCGTCGGGTGCAGACTGCGGCCAAGACTGTTGCTGATAGTGC
TCAAGACGAGGCAGTAGCGAGCTCTCTGTTGATTTCAATCCGCAAGAACTGCGTCAACTCCATCGCGATGCTCTGCTGCAACCCGAAGCTCCAAGTCCGT
GTGCGCAACACTGGCTTTGTTCCGAAGCTCCTAAACATTCTTCGAGGCGCTGACGACCAGGAAGACGATTACAGCGATGATGAAGATCACGTTTTCTCGC
GTGGTATTGATCCGGAAACCGAGAAATTTGTCGTTGTGGCACTCGCGAATTTGGCGCTCGACGATCGCTGCCGACCTACGCTCGTGCAAGACGGAGTAGT
TCCTCTTTTCCTTGGGTTATTGCGAGCTCCAGAACTCCCAGGGACTTACACTGAAGGCGTCGCAGATAACCAAGACGATAAAAGAGCCGCTGCTTTGCTA
CTTAAGTTGGATTGCGTCACGGCATTGAGCAACTTGCTGCTTCATCCAGCCAATTTTCAGGCGTTAGTGGATGCAGGTGTAGTTCCTGCGTTTTTGGATC
TTATCCGTAGCGAGGACACATCCGCTAGCAGTAGCAGCAAAGAGATCCAGAAGGCGTGTGTGTACGCAATGCTGGGTCTCGCCAAAGACCCAGGAGTGAA
GACTCGACTGGCGGAAGCTACTCAGAAGCGTCTTGATGACGAGGATTCAAATGACCAAGTCGGTGCAATCCCGACGATGCTGGCGTTCGCGTCGAGGAAT
CTGTCCAATGCTGAACTCTGCGGTGTCTGTATTAGTTTCCTACACCACTTATCGTCACGAGCTGTGAATCATGAGTTGCTATTCTATGAAGGTGCTGTGG
GGTTAGTCGTGCGTGTGTTAAAGAAACCAAGCACAGCGGAAGCACCAGCCACGATATACGCGCTCTGGTTGGACTGCCTAGCAACACTGGCCCACCTCGC
GTCGTACGAAGCTAAACGCTGTTCACTGCTGGACGATGGGGTTCTTGAAGCTATCCAACACTTCCTCATCGTCTCGGCTGCGGATCAGCGACCACGCGAT
GCAGTGACAGACCGAAGCATCATTAAGGCCCAGTACGCTGCTTCGCAAATTGTCTACAAGCTGCACGAACTCTGCAGTGGAATCTCTGTGTCAGCTGGTG
CCGGGCCGGTGGACGCACCCGCTTTCTTCGCGTGTTTGCTACTCTTGGCCACCCAGTCAGCGTCCAAGAACTCTCGATTGTCCAAGTCAACAGTTGCGCT
GCAGCACCGAACAGCTAGACGAACAGCACTTACGATCGCCAAGGTGGCGCTGGCTCTGCCACAAGGTCTAAGGCGGTTGGCGGAGCATGCTGATATTCCT
CCTGCTTTGAACATGGTCATGCGTACGGGTATTCATGAGGCTCAAGTTTGTGCTGCTGTTGCACTGTGCAACTTGGCAGCCGAGCGGCCAGCACCCGCGA
CAGGCAAACCCCTCTCGAGAGTATGGCGTGATGCAACGGTGGACGACTTCATCGTCATTACGCTACTACGAGTGAATAGTCCACAGACGAAAGGGATCTG
TGCGAAGGCCCTGTTCAATCTACTGACACATGAAGACGCACGCGACCAACTGATGCGGGATGGCGTTCTCTACGCTCTCTTGAAGCTGGCTCGGCTTGAA
AATGACTCGATCCGAGACCTGGCTCTGCGTGCTTTGTACAACATTTCTTTGGATGCTAAGAAGACGGCGCAACTACTGGAAATGGAGCTCGTGCGGATAC
TGGCAAAGATGTACCAAGCGGACCTGAATAAAACGATGAAGCGGCTCATGATAGGCATTTTCAGCAACTTATCAAGTGCTTCTTGTGCTCTCAACGATAA
AAATGCTGCTACCAATGACGAAGGTGAAGAGAAAAGTGTTGAAGGCGTTGTGGCTACCACGAAGACTGTCGAGTTGCAGATGCTTCAGGAGGGATTACTC
AGTGTCCTCAAGAACTTGGCCAAAGTGCGCGATCCTGAGATGAAGCTGTACGTCGCGAACGTGCTGTACAATCTATCGTGCGCTGTCGAGTCGCGCGTCG
TGGAGATTCTAGCTCAAGACGAAAGCAATGTGCTGGGAATCTTGATGGCGGAGCTCAAGTCGGAGAGCAAGGACGTGCGCAAGTACGCAGCCAAGACCCT
CGCCAATCTCAGTGTTTCTTCTGTTGCTGTGCAGATTATGACTAACGATGCGGCTTGTGCTGTGGTGAGTGTCATCAATGATACCATGAAAGGCGGAAAG
ACCAAAACAGGGTCGACTCCTACTGGAAGTGGGGCCTCGAGCTCGCTATCTGTCTGCGTCGAGACAAATTGTGCTTGTGTATTTTTCCTACGCAACCTCT
TTTCGTTGGAACTGAACCAGCGCAAGTTTATCGCGTGCAATGGGTTTCCAACTCTCGCCGCACTCCTCACAAGTCCAGCGATGGCTTCCGAAGCGCCGAC
TCTGCGTGTGGCTACCGACATGATCTGCTCGCTCGCTAAACTCAACGCTGAGTCTGGCAAACCTCGAGAAATGTCGTATGAAGAGCGTCTCGTGAGAGAT
GGGGTTGTTCGCGCCCTCGTGGCAATGGGCAAAGGTGCAATGGATGGATCAACCACACGGGCTGAGGAGAATGCGGCTTGTATGAACATCGTCACATCTT
TAAGTAGTTTGTCAGGGCACCCACAGTGTCACGACGCCATGTTGCGTGATGGAGCTCTCGACGCACTCGCAGTCTTGTGTGTGACGAATCCTTCAGATAG
TCGAACACCTTTTAAAGGTCTTGTCGGTGTACGTGGAGAGGCATTTGCTCTACATTGCATGGTAGTGATTCGGAATCTGTCGCGACAAGAACCGTCTCCA
CCTCCGTCTGGACCGCCGTCGATGGACAGTGAGGCAGGAAATGGTGGTCGTGCTAGTAAGGCAGAGGACGTGCGTAGTCAGAGACTGACCTCTCAACCTT
CCTTAGTGCCCATCGTGTTGGCATTATCGCAATCCACTAGTCCACAAACTCGCGAGCACGTGGTGGTCTCGCTCTACAACTTGGCTCGGTTGCGTCGTAG
TAAACGGCAGATGATCAAGAATGACGCCGTTAAAGTGTTGCTACGACTTGGAACGAGTGCTATTACGCCTTTCAAACGGCATGTCTGCTCCTTGGCGCTT
CAAGCTTTGGCTACTCATGTTCCACCACCAGCTCCAGCACAGTCAAATTGTCCCGACCCTACAGCGACTACTGTAGATGCCGCCGCCAACGCTGCTGAAT
GGGATGATCCTCACGTGGATAAAGTGGTTCAAGAGGGAATTGTGGCCGCAATCGCAGCTCTCGCAGACTCACATCAACACGATTTACTTGTCAGTGTGTC
GACGAACTTGTATGTGATTACCACTCCACCTCCGGCGGTCATGGAGTCAATTACTTTGTTGCGTACGACGAATCGAGCGATTGAGCAGCGTGGTGCTCCT
CCTGACTGGACCAAAGTGCTGATTACCGATTTGATCTCGTGGCCCGAGATTGAAATGGGTACCAGCAGAACCACTGCTATTCGAGTTGAGAGTAATTTGG
CTTTGGGGGCGCTGTCTCCTGGATTACAAGAGGAAGATCACGGTGAGGATCCCTACTCTGATGCTAGCGATGATGAAAGTCGACGAAAAGGCTCACAAGG
TAAATCGAGTGGGAAATTATCGAGTCCAAGCTCCTCAAAGAAACAGTCACAGCTAGGTCACAACTCAAATTTGGCTCCCCCGCGAACATGTAGCTCGGAC
GCGGTGTTGGGGTCTTTTCAAATGCTGGCAGATCCGAAACCAGAGAAAGTGCGAGTGAATGTGGAGTTTGAACTTGCAGGCCGTCGCGCTGTCACCTCGT
CTCCAGCTATAGCGTCTGCATCAAGTAATGATGAACTGCCAAAACTCCGTCCCGAGACGGCACCAGAGGGATTAACAGAAGATACTTCGAGACTTGGTGG
AAGATTACAGCTCACGCGTACGCAGGCGCGCCAGGATGCTGCGTATCGACGATTAACCAGCAACGGAATTTATCGAGGCAACACTCCAGAGAGTCCCATT
AAATCCTCGGCGGCTATCACAAAGCGGAGATCCCACCAGCTAGAACCGCTTTCCACCCCAAATTGA