Transcript Name :
Phyin_T30-4PITG_19200
Orientation:
(+)
Number of Exons:
3
Description :
Geranylgeranyl transferase type-1 subunit beta%2C putativeGeranylgeranyl transferase%2C putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-354
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1207 bases(100 bases per row)
ATGGCAACCACGTTTGACCGGGAGCTCCATACGCGCTATTTCCTCAAGAATCTGCGGTCGCTGCCTGAGCCGTACGCATCTCAGGACTCGCAGCGCGTGG
TGTTGGCTTTCTTCTGCATCCACGGGCTGGCACTACTGGAGGAACTTGAGCTCGTTGACAAGTGCCAGATCATTGAGTGGGTCTATAGTCTACAGGTGTC
TCCAGACTGCCGCGACGTCAGCCTCAATGCGGATGACTGCGGTTTCCGGGGCGGCACCTTCATGGGGAACACCTTTGGTTGCCCACCGTCCCAGTTTCAA
AGCGAGGTGTACGACTCGAGCAACATCGCGTCGACCTTCGCTGCGCTCTGCATCCTCCGGACGCTTGGCGATGACCTCAGTCGAGTGAACAAGGCCGCAA
TCATTGGATCTTTAAAACATTTACAGAACAAAACGACAGGATGGTACGGGACAAGCACAGATGGTACAGTCCTGATGCTGATGGTGGTTCTGTAGCTTTT
CGTCAGCAAACGCTGGATCGGAAGAAGATATGCGCTTCGTCTACTGCGCCTGTGCCATATCTTACATTCTGGAAGACTGGTCCGGTGTCGATCGGGTGGC
GATGGTGCGCTTCATTAACTCATGTCTGGTATCTCTCTCCCTCTAGTATTCATCAACTCGTGTCTGGTATCAACACGTATACACGACTGCTGACAAGATC
GTTCGTTGTTGTGTGTAGAATTATGACGGAGGCATCGGGCTCAGCACTGGCGCTGAATCGCATGGCGGGGCAGTATTCGTTGCCATCGCGTCGCTGTTTT
TGTCTGGACGAGTGATGCAGCTCAAGTGCGAGCAGTCGGATCTGGTGCGATGGCTGGTGTTCCGACAGCAAGGAGGTTTCCAGGGACGATGCAACAAGAG
CCCCGACTCCTGCTACGCCTTCTGGAACGGCGCTACCCTCGACCTCCTGGGCAAACACTCGTTTGTGGATATCCCCAGCTGCAAGAAGTTTATCTACTCG
TGTCAGTTCCCCTTCGGTGGATTGTGTAAATACCCCGACACCGTTCCCGACGTGATGCATTCGTACCTTAGCCTGGCGTGGTTAAGTATCGCGGTAAATT
CAAACACGATCGTGGTCGATGGAGAGGAGCTTCCTAAACTTGCACCTCTGGACACGAAGCTCCAAGTGCCGTTTTTCCCAAAGCTCCACGGCACGACAAA
AAAGTGA