Transcript Name :
Phyin_T30-4PITG_15392
Orientation:
(-)
Number of Exons:
1
Description :
Leukotriene A-4 hydrolase-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase M1, membrane alanine aminopeptidase, N-terminal3.5PR00756
Peptidase M1, membrane alanine aminopeptidase, N-terminal3.5PR00756
Peptidase M1, membrane alanine aminopeptidase, N-terminal3.5PR00756
Peptidase M1, membrane alanine aminopeptidase, N-terminal3.5PR00756
Peptidase M1, membrane alanine aminopeptidase, N-terminal3.5PR00756
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
668-670
1-647
648-667
NN-scoreoddsWeighted Score
0.5851.3620.003
*** None ***
TypeScore
cytoplasmic304
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
metallopeptidase activityGO:0008237IEA
KO ID
K01254
Cluster Id
486
Sequence
        2013 bases(100 bases per row)
ATGGATCAAGAGCGCCCCCTTCGCTCGCATTCGTACTCGAACCTGGACGAGGTGACGTTCACGCATCTCAATTGGGTCATTGCGCTGGACTTCGCAGCCC
AGCAACTCAAGGGATACGCCGAGTACACGTTCCACCACGCCTCGACCGCCACGTCCTCCGTTGTGGTGCTGGACACGCACCATTTGAGCGTCTCCAAAGT
CTATGCAGACGGCAAGGAGACGCCCTTCGCTCTGGCCGAGAAGGAGCACCCGGTATTCGGCCGCGCACTCGTGGTGTCCGTGCCCAGCCACGCCACGAAG
ATCCGTGTGGATTACACCACATCCGACGCCTCCAGCGGCCTGCAGTGGCTCAGCAAGGAGCTCACAGCCGGCAAGACGCACCCGTATCTCTTCACGCAGT
GCCAGGCCATCCACGCACGCACCATCGTGCCGTGTCCGGACACGCCGGCGTGTAAATTCACGTACTCGGCCACAGTCACGGTGCCGGACTGGTGCACGTG
TCTGATGAGCGCCATAGCAGACCCGCAGGGCCGCAAGAACCACAACACTATGGACGCTACCTACCAAGTCTCATTCCAGCAGTCCGTGCCCATTCCTTCC
TATCTACTGGCCATCGTGGCCGGTAAACTGGAGAGTGTGGACTTGGGGCCACGTAGTCGCGTGTGGGCGGAGCCTACGGTGGTGACGAAAGCTGCCCACG
AGTTTGCGCAGACGGAGGCGTTCTTGCAACACGCCGAGGAGATCACAGGCCAGGAGTATGTGTGGAAGCGATACGATCTCGTGTGTCTGCCCCCTTCTTT
CCCGTACGGAGGCATGGAGAATCCTTGCTTGACGTTTGTGACCCCCACGCTGTTGGCCGGAGACCGCTCGCTTGCTGACGTGGTGGCGCACGAGATCTCG
CACTCGTGGACGGGGAACCTCGTGACGAACCGCTCGTGGACCGATTTCTGGCTCAACGAGGGCTGGACCATGTGGCTGGAGCGGAAGATCCAGACGCGCA
TCGCACAGGACCCCAAGGCGTACGACCTCAAGGCTGCGATGGGTCTACGCGACCTCATCGAGTCAGTGGAGGAGTTCGGCCCCACCCATCCGTACACGGC
GCTGGTGCCCGACACGGACGGCGTCGACCCGGACGAGGTGTTTTCCTCGATTCCGTATGAAAAAGGCTTTAATTTCCTACACTATCTGTCAACGGTCGTC
GGTGGGCACCAAGTGTTCGATACGTTCGCCAAGGCTTACATCCAGGAGTTCAAGTTCAAGACGCTCACGTCGAGCGACTTCCGTGCGTTCTTTGAGAAAT
ACTTTGCCGACAAGCAGGAGGCGCTTCGTGCGATCGACTGGGAGGCCTGGTACCACTCGCCTGGCATGCCGCCTGTGGCCAACAAGTTCGACACGACGTT
GACGAGCCAAGCGACCAAGTTGGGCGAGCAGATGACGGCGAGTAGCAACGCGGACACGTGGACGAGCGTCGCGCAGGATGTGCTGACGAAGTGGCCCGCC
AGTCTGTGGATCTTGCTGCTGGACACGCTGCTACTGAGACAGGAGCACGCGCGCTTGACGCCGGCCCACTTGGACGCGATCGACTCGTTCACGCAGCACC
ACTTGACGACCACACACAACTCGGAGCTGCGATTCCGGTGGTACACTGTGTTGCTTCGTGCGGGCGACCTGCGTGTGCTTGACAGGACTGTGGAGATGCT
GAAGGAACAGGGTCGGATGAAGTTCGTACGTCCGCTCTTCCGCGACCTGTGCACAGCGCTGGGTCCTGCACAGGCCGAGGCAATCTTTGCGGACTGTAAG
CATCTATATCACCCGATTGCAGCTAAGATGATCCAGCGAGACATTGAGAACAGCATCGCCAAGGCTAAAGGCAGGAAGGTCAAGTTCGCGTCCCCCACGA
CCCCGAGCGCTCTGGCTCAATGGCTGGGAGTGTCGGACGAGATCGTGACCTATGCGGCTGTGGCCGCTGCTGTCACCACGGTGGCACTTGTCGTCGTCTC
TCGTCGGCGGTAG