Transcript Name :
Phyin_T30-4PITG_10835
Orientation:
(+)
Number of Exons:
1
Description :
Secreted RxLR effector peptide protein%2C putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-72
230-242
93-206
73-92
207-229
NN-scoreoddsWeighted Score
0.8634.6030.009
*** None ***
TypeScore
mitochondrial435
GO
*** None ***
*** None ***
*** None ***
Sequence
        726 bases(100 bases per row)
ATGCGCTTCTGGTTCACGATCACAAGCAGAATCTCTGCACTCGTGATTGGATACATGTACATGTACAAAACACTCGAACAACATGTAGGCTGCCTACAGT
GGGCATCACGCATCAGGTTAAGAGATTCCCAACGCTCTTCACTTCATAACCGGCTGGTAAACCCACAAGTGCAGTTATCATTTTTCAGATTCTCCTCGAA
AAGTCATGATGCGAGAAGCTCCCTCCTCCTGGTGGCTATCACGCTCGTTGCAGGCTGCGTCGGCTTCATTACCGCCGAGAACTTTGTCCAAACGCAAGGC
CAGCCGTCTGCCTTTGAAGTCTCCCAGGGCCGCAACCTCAAGTCTACAGCTGATACAGAAGAGAGGGCGATTCCCGTGGACGGCGAAACTAGAGCCGGAG
TGGCGGGTATTGCTGCCAGGGTCAAGGCGCTTTTGGTTAGGAATCCGACCAAAATGAGTGAGGCGAAGAACAACGTGCAAGGGGCGAATGAAGCAATAAA
GAAGGTGAACTCGATCATTGGTCCAGGAAAAACTAGGACCGAGCTCACTCCGACTAAGGTGAAACAACTGGAAACATACGCCCATAGCAGCTCGGACAAA
TGGTGGGCTATGGCGTACTACACCGCTAATATTCTCGGCATCGGACTCATGGTTTTTTTTGTGTACGGCACTCTCTTCCTCGGATGGCGCCCAATCGGAA
TGGGCGGGAACCCGAGGCCCAACAAC