Transcript Name :
Phyke_g8628
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_535936
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5270.58628
InsideOutsideTMhelix
300-343
404-415
471-506
557-568
634-644
1-276
367-380
439-447
530-533
592-610
277-299
344-366
381-403
416-438
448-470
507-529
534-556
569-591
611-633
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2203 bases(100 bases per row)
ATGTTGACGTCTGGATTCAGTAAACcgctgctggctgcagcgGCAATCGCTGTGGCGTCTTGGGGCACCCCCAGCGAGGCCTTCTCGCTGCCTGGTGTAC
AAATGACCACGTACTCGAAGGGCGAGGTGCTGCCGCTCTTCGTCAACAGCCTCAAGTCGgcggagacgctgctgcctctggacTACTACAAGTTGCCGTT
CTGTCAGGTAATGAAGCTGTTGATGTGTTATTCAGGGTCTGGAGGTGGTTATTAGgagtgatgaagacgttAAATCGGAGTGGATGATCTGACGTCGCAG
TATGTTATTTTTAGCCGGAGAAAATTGAGTATAAATCGGAGAACTTGGGCGAGTATCTAACAGCAAATCGGATCCAAAACTCGCCATATGAACTCAAGTT
CCTGGAAGGCCAACAGTGTGCTGTTTTGTGCCAACAAGAGtacgaggagaaggatgTTAAGAGCTTTGagaacaagatcaaggacTCGTACCGCGTCAAC
TGGATCCTGGACAATCTGCCAGCCACTTTCCTGTCTTCTGAAGGTGGCATGACGGTAGGCTTCCCATTGGGAAGCTTTAATCCTgaggtggaagtggtgc
CGCAGCTCAACAACCACGTCAAGATCTTGATCggctacaacaacaacccaCTGGGCACAGCTGAGGCCTCTGAGGATGAAGGTCGCATCGTGGATTTTAA
GGTCATCCCCTACAGCTTTGACTATTCGACCAAGAGTTACGACAAGGAACTCAACCGGATGGACTCGTGCGAACACTCGAGCGAGTTGAAGCGCCCACTG
TATGTACGCAAGAACAAGGATGGCAAGATGCCGGTGTTCTGGACCTACAGTGTGGAGTGGGTGCAGGACAATGAGCACGAGTGGCGTACGCGGTGGGACG
TATACTTTGACGCTGGCTCGGGAGGCGATGAGGTCCACTGGTTCTCCATCATTAATGCACTTGtgatcgtgctgttcctgaGCGGTATGGTGGGAATGAT
TCTGATGCGCAGTCTTCACCGTGATATCAGCCGGTACAACCGCGTGCCTACGGAGGAAGAACGCGCTGAGGAGCGCGAGGAATCTGGCTGGAAGCTTGTG
CACGCTGACGTGTTCCGTCCGCCGTCGAAGAACCCGATGCTTTTCTGCGTGATGGTGGGCACAGGTTGTCAGTTGCTGGGCATGGCGCTCGTCACGCTGt
tctttgctgctgtgggcgTTCTGGCGCCCTCGAACCGAGGTAAACTTGTGATCGCGCTGCTCGTCtgctttgtgctgctgggtATGCTGGCAGGCTTCAC
GTCGGCGCGCACATACAAAATGTTCAAGGGCAAACGCTGGCAGCTGTGCACGGTGCTCACGGCCGTGCTGTTCCCTGGCATCATGTTTTCACTCTTCTTT
TTCCTAAACCTTTTCGTATGGGGCGCTGGTTCGGACGCCGCTGTGCCTTTCGGTTCCATTctgcttgtcttcttcctttGGACGGGTATCTCTGTGCCAC
TTGTGTTTGCTGGTGCCTACTTTGGCTTCAGGTACGTTTGCACGCCGATTTTCTTTCGTGAATCGTGAATAGGCAGCTGATGACCTGTTTTGCTTTGTAA
CTATCCACAGGAAAGCGCCTGTTCCGTTCCCGGTAGCAACGAGCAATATCCCGCGCCCTGTGCCTCCTCAACCATGGTACATGACCCACATGACTGCAGC
GGCCGTGGGCGGCGTGCTGCCGTTCGGTGCCATCTTTGtggagctcttcttcgtgctgtcgtcgctgtggACGGACAAATACTACTACGTGTTCGGCTTC
CTGTTGCTTGCCTTCCTTATCCTTATCAACACGTGTGCAGAGATTACGATCGTGCTCACCTACTTCCAGCTCTGCGCCGAAGACTACAACTGGTATGTTT
GGAAAGCCTTCTCAGTGAAGTTTAATGTATGGTTTGACTGACGTATGCCTCGTTGACgttgttttgctgtgcagGTGGTGGCGGTCGCTCTTTGTGTCAG
GAGCTTGCGGCGGCTACGTGTTCCTCTACTCGACGTATTACTTCTGGACGCGTCTGGACGTCGCCAACTTCATCGGTGCCATGCTCTACTTCGGTTACAT
GGCGGTCATCTCAGGCGCGTTGTCACTGCTGACGGGTGCCGTGGGCGTCGGTGCGTCGCTGTGGTTCACACGCAAGATCTACGCGTCCATCAAGGTCGAC
TAG