Transcript Name :
Phyin_T30-4PITG_08836
Orientation:
(+)
Number of Exons:
3
Description :
Putative uncharacterized protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-525
NN-scoreoddsWeighted Score
0.5541.2530.003
*** None ***
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        1745 bases(100 bases per row)
ATGCCCCGCGCTTCCAGCACTCGCACGACGCCCCGCAAGGATGTCGACCAGCGGTTCGTCTTCCTCGATCTCGACTCGCTCCTCTGCGCCGTACGCAGCC
ACGTTCTAACCCACGAGAATCAGTTCCACAAGGAGCTCGCCAGCTTCTCCAGTGACGTTGCACTATGCCCCAACAACCTCACCGTCCTATTAAACGACCA
GCACCCGAGTCGTATCCAATGCTGGAGAGGAACCTACTGCAATCCCAACGCAGCCGAGGCCAAAGCCCTCGAGGGTGTGCGCAGTGACGGCGGCACGAAG
ATCAGCTGGAAGCTCACACAGAAAGGGACGTCGCAGCATCCGACACTCGAAAAGATGCTCAAACGCCACTTGACCCCCACGAACGGCGCTAAAAAGACGC
TAGTTCTAGCCACAGGAGCCCTCACCAAAGGTCTAAAGAGCTGTGTCGACGCCTACTTAAAAGCGCACTGGCACGTGCAGCTCGTGACTCTCGACTCGTG
TTACACGAAAAGCGACTGTAAAGTTACAGAAGTCGACGGGTTTGACGTCAAAATAGTGGACAAATACCTCCAAAAGCTGCTAACAGCGAGCCATTGCGGA
GCCCCGAGCTTTGAGCGCAAAGTGAGTTCCCCCACACTGCGCAGTTGTACCAGTCCAGTTAAGCCCCCCACACCTTCGTTGCCCGTAAATTATCAAGCTG
TTCACGAGCATAGAAGAGCAGCGATGCTTGGACAGGAATTGAGCGATATCGAACGTCGTAAAGCGAGGTTAGCAAACCTCCCGACCGGAAAATACGCAAT
GGGCAATCGCCAACGTCACGTTTTCATGAATCTTGACAATATCGCAGGTGCTGTGTGTAATAGTCAATGGCTGTATCAACGGATTGCCGGCGCTAGCAGC
GGCTACGACGTGCGGCTGAATTTTCGGGCTTTGACAGAACGTGTATGTGGATCGAAAGAAAGTCAGGTGGTGCGCCGACTGGCGTCGTATCGGAAAATGC
CTCGAGAATTGGCATTGCCTCTGCAAGAGTTTGACTGGGAGATACACGCTTTGAGTCAAAGCTGCAGCGGGAACAAAGGACTGTACTATGTGTTGTTGGA
CTTGCTGGAGACTGCGGGCTCGAGCAAACGCAAGAATACACTTGTGTTGGTTATGGGCGATGGAGCACTTGGAGGCAGCGGAATGGAGCAGAAAGAAGCG
ACCAAAGAGTTGTTAAAGAAGTTCCTGGAGAAGAACTGGTCTGTGGAGATCCACTCATGGCTACACGCTCTGAACGACTGGTTTATGGACATTCAAGAGC
AGTATCCGTACCGTGTAGCCGTGAAACCTTTGGACGACGCTATACACGACTTAATTTACCTGAAACAAGACGAGGAAGACGTGTGGGTGGAGCCAGTGTG
GCCTGGTAGTCATCGAGAAGTTGAGGCAACTCTAACGAGCTCTCCAGTACCGCCATCGCCACCTCAGTCAGCGTGGGGAACGACTGCGATCCCAACGTTG
TCGTTATTTCCTAGCACACCCTTTCTGACAATGGAGCAGAAATTGGAGCAGCAAATGAGGCTGGAAGATGAGCGGAAAGATCTACGCGAACGTCTGCGTA
AGAACCAGGAGGCACTGGATGCTCTCGAGTTGGAATCGTGGTCGATGCAGATTCTGCAACAGCAAGAACTGGCGCGAGTGGCGCAGCAGGCGAGTGACAA
GCAACTGGCGATTCACATGGCTGAAGAAGAAGAACTGCAACTTAA