Transcript Name :
Phyke_g8875
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, BED-type predicted9.608PS50808
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-813
NN-scoreoddsWeighted Score
0.5871.5880.003
*** None ***
TypeScore
nuclear391
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
*** None ***
*** None ***
Sequence
        2442 bases(100 bases per row)
ATGGTGAAGAGGTCCTCGGAATTCCCTGggtctgctgcgtcgtccTCACCAGCGTCTGGTAGCCATGGCACTACGCCTCTCAACAGCGGTCCTGCCAGCG
TCTCAGCCGTCTGGACATACTTCGAGAAGGACTCGACTGGCAACTCCATCTGCAAGTTCTGCGAGCGCGTGATCAAGGGCTACCACTCATCCAATCTGCT
GAGTCACTTGCGCACGGCCGGACGCACGGACCCCACGCACCAACAGGCAAACAACGTGTGCGAGGAGCATCGAGAGACCAAGCGTCATATCAAGCGCCAG
AAAATGGGGCTCCAGGCGGCTGCAGCGGGCCAAACGGGCGCGGAATTCATGGCTGCGGCCATGTACCCGGTCCCTGCAGCCTCTCAAGCCCTTGCAGCGG
CTGTAGCGGCCGCTGGAGGCTTCAATAGTGCCCTGAAACGGGATGCAACCGGTGCACTCTATAGCTACTCACCACAagccagtgctgctgcagtgactCT
TTCAAAAGAACAGAGAGAAGTACTGGGCTCAGCTTACGGGATGCAGCCTGTACAGGTAAATGCAGAGCAATTCACTCAAGATCTGGCGCTCATGGCGCTT
ATGGACAACTTGCCGTTGAACTTTACCTCTAAGCCAGGTATGCAGTACGTGATGAACCAGTTACTGGGAGACAAGAAGCTGCCGTTGCCGAGTGAAGATG
CACTGGGCAAGAGCATCTTGTTGCTACAGGAGAGTGTATTCCTAACCACGAAGATGCTTGTGGGTCGCGCTAAAAGTGTGACGGTATCGCTTGAGGGATG
GCAGCATCCGTCTCCAACGAAACCCAAGCCTACGCAGtatttggtggtgaagatTCACTTCAGCGTGAATTTTCGGCTGTTCGAAATTGCGGTCGGCTGC
GCACCGCTTGATGACGGTGCCAGACTCGACACTATTAAGGTCGTCTTGGACTCGTACTTGGAGCGTTTGGGTGTAAAAGACAAGGTCATCGCCTGTGTCA
AGGACGATATGTCTGTCAACGTAGAGGTGACGGCGGCCGACCTCCCGTCTCTATTCATACCGACAAACTTTGACGGCCGGATTGTGTCCCCCGATGCGGC
ACAAAGCACGCTCCTGCTTACATCAGCAGTGCAACATCTGCGCTTCTGCCTGACCAAGAAGGTATTTGCTAAGTCGTTCCCCGAGGTGGTGCATCAGGTG
GAGGAGTTCGCGGCTCGGCTGGCGGAGAATGAAGAGGCGATATCTTCTCTTAGCCGCAAGTCCCCGCTCTTTAACGTGGAGTTCTCGCCTGAAGGACACG
AGTCAATGTCTTACTATGAGTTTCTGCGTGACTTGCTGGAACATTTGCCtatgctggagcagatcgCAAATGCACATCTCGTGGAGTACCTTCCGATAAC
AACAGTGGAGTTCATTGGTCTGCTTGTGAAGAAGCTACGGCCATTTTCACGCTACTCGGAAGCGCTGGAAGGAGAGAAGAGCAGAAAGACAGGCAGCGAT
AAGGAGGTCAACAAGAGCGGTATTTCAAGCATTTCAACCATTGCGGCAGCTCTCGTAGCATATGCAGAGAAGCAAGGGCTATCAGCCACCGAGAGTGTAC
CAGCGCACCTGGATCCAGCAATGtggaagcgcttcttcgatACGTTGGCTAAGAAGCTGCGTGATCATTTTATGACGCTACCACCGATTTGCTACGCGGC
GACACTCTTTGACCCGCGCTACAAAAATCGTGAGTATTGCTACCTGTCTCCTAAAAGTGAGTGTGACGTTGGTAAGGAGTATCTCCGTCGTTTGTTCACC
CCTGACGGTGAGTCAACACAGTCGTCAAGTGCTTCTGGCACCTCTGCACTAGCAGGAGGTGTGGATTCTAGTGACAGTGTGGTTAGGATTACAACGGCTT
CTTACGCTGAGCTGGTTAAAAACGACTTAAAGTCGTCTAGCCCTACAGGCAACGACGTGCAACtcgctgatgatgaagaggatgatcTACTGTCTCACTT
GCCATCAGGGTCGTCTAAGACGTCACAGCAAGATGATAGCGAAATGGTGGCGACTTGGGAGAAAGAGCTGAGCGCGTTCTTGAGTCTTCCTGTTGCGGAA
CGGAACGTGGACCCGTtgacgtggtggaagacGAACCAACTGCGCTTTCCGCTGATCGCGCCGTACGCTGAAATGGTGTTGTCGCTGccggcttcatcgt
cgagTGGCGAATCTGTCCGCAACAACGTCTACAGTGTGCTTCTGCGTACCGAGGGCCTTGGCCGTGAGAATGCTCTGGCTGACAGTCCAGCAATGGTCGA
GGCCTTCTTATGCTTCCAAAAGAACAAGGAATATGCACTGGAATGGTTCCGATCCGGTTCGAGCAGCATGGCGGAGACTGCAGGTATGCACTCTGATCTG
GAAAACAGTGCTGCAAATTTCAAGCATATTGAAAACGTGTGA