Transcript Name :
Phyke_g8143
Orientation:
(+)
Number of Exons:
1
Description :
flavodoxin/amb allergen/pectate lyase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Pectate lyase/Amb allergen2.3SM00656
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pectate lyase/Amb allergenIPR002022
Y-scoreD-scoreY-pos
0.8020.84222
InsideOutsideTMhelix
1-400
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1203 bases(100 bases per row)
ATGAAGCTTTTCCGCCCCATTTTCATCGCGGTGGTagccttcgtcgtcaagtCCGCGGACGCCTTCACAGTTGGGTCGGCCACTGGCCTAGCAGCCGGTA
CGACGGGTGGGGGCAGCGCTACTGCCGTGTACCCGACGACAACAAGCCAACTAGAAGCTTATCTCAAGGATTCTGTACCGCGAGTGATCGTCCTGAACCG
AAGCTTCGACTTCCGCAATACCGAAGGCACCACGACGGAAGCTGGCTGCCGTCCGGACTACACACGTCAATGCATTGCCAAGAACAACGGCTACAAGAGC
CAAGATGTGATTCTCCAGAGCGGCGGCATGTCCAACACTGGCGGTTGCTCGGATGGCACCAGCGTGACGGTGACCTACGACAACGCAGCCATCACGCCAC
TAACTGTGACCAGTAACAAGACCATCCGCGGTATCGGGACGAGCGGCGTGCTCATGGGCAAGGGCCTATGGCTAAACggcgacaacatcatcatcCAGAA
TATCCACATCACGGAACTGAACCGCCATCTCGTCTGGGGGGGTGACGCCCTCTACATTCAAGGCAGCAACGGTGGTTCAACGGCGATGAACAAGATTTGG
CTCGACCACATCAAGGTCTCTCGCGTCGGTCGTCAGTTCTTGACGACGAACGCGGCCAGCGTGTCCACGATGACCATCAGTAACTCCGACTTCGATGGGC
GCACTGACTACTCCGCGTCGTGCGACGGTCGCCACTACTGgtccttcatcttctacGGCAAGAACACCCGCTTCAGCATGGTCAACAACTACATTCATTC
GACGTCCGGGCGCTCCCCCAAGCTCGGCGGTGACAGTAGCGCCAACGTTATTGCCCACATCGCGAACAACTACTGGGCCGACAACTCCGGCCATTCTTTC
GAGGTTGGTGCCAACGCGTGGGTTCTCGCGGAAGGCAACTACTTCGAAGATACGACGCTGCCTTTGGCGTCGGGGAGCGACGGCTACATGTACGCTGCCA
CTGCTACCACCGAATGTCAGAGCTACTTGGGTCGTTCGTGTGCGGCGAATGTAGTGGACAACAGCGGCTCGTTCGGTTCGCGGAGCGGCTCCACGGCGTt
gtcgaaggtgaaggcgTACTCGGCGATCTCGGGCTACAGCCCGCGGTCGGCGAAACAGTGGAGCAAGACGGCTACGAACTTCGGTATTGGTGTGCTGAAT
TAG