Transcript Name :
Phyke_g8151
Orientation:
(-)
Number of Exons:
1
Description :
ABC transporters ABCA family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like19.161PS50893
ABC transporter-like17.234PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain9SM00382
AAA+ ATPase domain4.6SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
161-207
308-326
387-392
485-971
1118-1142
1203-1214
1272-1328
1-137
231-284
350-363
411-461
992-1094
1166-1179
1238-1251
1352-1859
138-160
208-230
285-307
327-349
364-386
393-410
462-484
972-991
1095-1117
1143-1165
1180-1202
1215-1237
1252-1271
1329-1351
NN-scoreoddsWeighted Score
0.7483.2860.007
*** None ***
TypeScore
endoplasmic reticulum778
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        5580 bases(100 bases per row)
ATGGCAGACGCCGGATCTTCCGACGACGCCGCTGAGAGCGCTACCCTCACGGCGCTGTCCGACTGCGTGACCACTGTGATCGCCAACGACATCACCTACG
GTCTCTGCGTGACCAACTCGGGGCTCTTCGACCTTGTTCCAGACGATTTCCAGgacaataacaacaacaattcctcatcctctttttcttcttcttcctc
agaCGATAATGACAATTTCAATGGCGACTCTGCCTGTCGCGTCATGTGCTCCAAACAAACGACGTCGGCGTCATCTTCCTGCTGTACCGCCGCGGCGTCT
CTGCGGTCCTGCAACACTTCGTCAACAGCAGTCACAACGTGCAAAGAACTCTTCGACAGTGTCTTCACGTACCAGAACGAGTGCGATGGGGGCTTATCGT
CGGCCGATACGATCATGACTGTAGTGGTGGTTACTCTAGCAGCAATTGTAGCAGGAGTTGCTGTGTTTTCGAGACTATATGGACGGCGCAAGCAACATTT
AGAGactcagcaacaagcagTGGGGGCGACGGCCACAGGATTCGCTGCTCGCGTAGCTGCGACGTGGAGACAAATTACCAACTTAGTGTGGAAAaacatg
ctgctgcgccGTCGGAAACCAGTGTCACTTGTGATGGAACTCTTTCTGCCAGTGCTCTTAGCAACGGCGCTACTGTTGCTCGCGAACCTGGATTCCATTG
CTGGAGGTTGGAGAACGACGTGGTTCACGTCGGAAGCAGCTGTGGTCGCTGCGAATGAAACGCTGATATGCTCCGATTTAGCAGTTTGGGGCATCGAGTC
CATCGGCGGACCATCGTCGACCATGACGTCGTTCTACACGGGCGGCCAGTCGGTTCTGGGGCTTTTTTTTCTCGTTAGCTACATCAAATTTGtgtccacg
accacgacgacaaTGGTCATTGAAAAGGAAAACAGACTGCGTGAGGTGATGAAGATTATGGGCTTATCAGACGCCACACTACTCTGCTCGTGGTGCCTCA
CGACGGCAGTGCTGGCCACGCCCCTCGCGTTCGCGATATCTGCTGAGCTCAAATACGGCAATGTGTTCCCCACGACTGAGTATGCGACCCTGGTCTTTCT
CTTCTGGACGCTCAGCGTGGCCATCACAGCCTTCTCGTACTTTATCGCCCCGTTTTTCAACAAGTCACGAACTGCCGCTATCgcttcggtgctgctgtgg
ctcaTTCTTTTCTTCCCATTTTTCGCGGTTCAGTCTGCAGACACAAACACACCAAAGTACTGGGCCGCATTATCACCACCCACAGCGTTCGCGCTAGCTG
TGGACGAAATGCTACGGCGTGCACAGCTTGGTACGGGCTTCGCGTACTCGGTTGGGTTGCGGGAGGAGCCTGTGACAGTTCCCAGTGCCTTCGAGATGAG
TCTGTTCCTCATTCTGGACTCTGTCCTGCTTGTGGTCATGGGCTGGTAcctggagcaggtgctgccTCAGCAATACGGGGTGAGGAAACCTTGGTACTTC
TTGTTCACGAAAAGCTACTGGATTAGCAAGTTTGGCTCTGTCAAAGACGATGGTCTGACGAGTGGTGACGTCGAAGTGATCCCCGCGCTATCGCCTCAAG
CTGGTGGTGCCTACACACAGCTAATCGACGGTGATAACTCTATCAAAGAAGACAAATCGGTGATTGAGAACGCATACGTGGAGCCTGTCAGTGCGACGCT
AGCGATACAAGAGCGCAACGGTACATGCCTGCAAATTCGCAGGTTACGAAAGGTATTTCCCCtggaagaagacggagaagaacatgttgctgtggctggG
TTGGATTTGGCGATGTACAGTGGCCAGATTACAGCACTGCTCGGGCACAACGGCGCCGGTAAGACAACCATCATCTCAATGCTGACCGGTCTGATCCCTC
CTACATCTGGAGATGCTACACTGCATGGGTGCTCCATCAAGCGCGACTTTCATGAGCTACGGCGCGTCATCGGGATTTGTCCTCAGCATGATGTGCTTTT
CCAGGACCTAACAGTAGAAGAACACCTGCTTCTCTTCGGCACGATGAAGCATGTGCCGCGCGACAAACTCCAGAGTAGCGTGGACAAAATGATTGAGGAC
GTCGGGCTGACAGAGATTCGGCGTGCCCTTGCAAAGACACTATCTGGCGGTCAGAAGCGCAAACTCAGTGTCGCGCTCGCATTCCTCGGCGGGAGTAAGC
TTGTTTTTCTGGATGAGCCCACATCTGGCATGGACCCGTACTCTCGGCGCTTTACGTGGAACTTGCTCCAACAGAGTCGTGAGGACCGTGTCATCGTCCT
GACTACGCACTTTATGGACGAGGCGGATATCCTTGGCGATCGCATCGCCATCTTAGCCGATGGCCAACTGCGCTGTGCCGGTACATCTCTATTCCTAAAG
AATCGCTTTGGTGCAGGCTACAATTTGACTATGATCAAGGCTTCGGATGGCTCGTGCGATGTGCATTTGGTCGAGGGCTTTCTCAAGAAATATGTACCAG
GTGCCAAATGTCTGAGTAGTTCCGGGTCAGAGCTTGTGTTTCAGTTGCCAGCAGTGTCTTCCGAAGCTTTCCCGTCAATGTTGGAGCAGCTAGATACAGA
TATGCAAGAGCTTGGTGTGCAGCAGTACGGCATTTCGGTGACTacgctggaggaggtgtTTTTGCGGATTTCACAGGATCGCGACGAGGATGAACGACAC
GAAATAGGACGGGACCccatgctgctgccaacctTGGAGCGCAAaccctcttcttccttgatGGGGCATGCTTCAGTGAAGTTGCCGTCTACAGAAGGCG
CACTGAACGTACCATCGACAACGACAATGCCGCCAATCCGTGAACCAACTATGTGGACCCAGTACATGGCATTGACGAAGAAACGCTTCCAAATCGCGAA
GCGTGACAAGAAAACCCTGGTGTACTCGGTGGGCATTCCGCTTATTTTCTTGATCATTCTCGCGGTGCTCCCAGAGGTCAAGGTGGCAGACTTTATCCCC
AACTATGCCTCGAATCTTCCGACTGAAGCTCAACAGAGTCAGTGCTCGACTACTAGTTTCAACAGCCTTGTCAATGCAGACTACAACGCCTCGGCATGTT
TGGGTCCTCGGGGCTTCGAATACTGTTCGTTAGGTGCTATTGGCTGCGACGCCAATGCATGCTGTGACGTGTCCAACATTGCGTCGCCATGGTACCCGTG
CAACACGTGCGACTCATCGCCGTGTTTCAATAATAATTGCCtcgccaagaacaacgcGAAGCTTCAAGTGACTCTGAATGGTTTTCTGGTGGCGCTCGTT
GTCATGTTGGCGTTTGCGTTCGTCCCGGCAGCTATTGTGGCTTTCGTCGTGCGCGAGAAGGACCCCGTCCAGAACGCTAAGGGTCTGCAGCTTATCAGCG
GCGCCAACATCTCCGCATATTGGTTAGCGAGCTGGACACACGACGCGCTCTTGACGATTGTTCCGATCGTCGCAGCTGTGATAATTATTCCACTATCGAT
GGTGCCCAATGGTGCAGCAAATGCGAGTGCAGAAGATGTTGCAGCGATTACACTGTTGGTGGTCACTCACATCTGGGCAATTATCCCATTGGCGTACCTC
TTTTCAAGACGTTACACCAAGCATGCTGTTGCACAGACCGCGTTACTCGTATTTGCGTTAGGCACCGGCGGCTTGCTGAGCATCTTCTCGTTCATGTGCC
GCATCGTGAACTTCACCATTTCGGGCTCTTTGACGCTTTCGTCTCTCGACCGAAACTACCTACGGTGGGTCTTCATGATATTCCCTGGTTACACTCTGAA
CAACGGCATCTTCGAGTTGGCCACGCGAAAGGTTAGTCGTCGGGCTTTGTTTGGGTCAGGTCGTTGGACCTCAATGAGCCCGTCCTTTTTCGGATTGTTT
GAAGGTCTGGGCAAAAGTGATTGCTTGGAGTGTTGGGATCGCATATCGGATTCATGCTGTGTGAGACAGCCATTTGATTTGGAGATTGTTGGAGCTCCGC
TAATGTACACGctggtggaagctgctgtgcTGTCCGTGCTTGTGTTCGTATTGGAAAATCGCTCACTCCGGTGGAAACAGGACGGGGTTTCGGCGCAGCA
AAATGAGAAAAATCGCCATAATGTAGTACGAATGGATGCTGCCGATATTactgaggaggaagaagaagacgatgacgtGCAGCATGAACGGCAGCGTGTG
GAGCAAGAGCCTCCGCAACCCAACGACCTTGTGTTCATTCGGAACTTGCGACAGCAATACGCTGGAAAGCCACGTGCCAAGATTGCGTTGAAGGATCTAT
GTCTATCGATTAAAAGTGGTGAGTGCTTTGGCTACCTGGGCATCAATGGGGCGGGGAAGTCTACAACGATGGCGGTGCTCACGGGCCAATTGGTGCCCAC
CCACGGCTTCGTCACACTGAGTGGCTACGATTTGTCCACCAGTTCGTTTGCAGCACGGAAGACGATGGGTTACTGTCCACAGTTTGACGCACTACACGAC
CTACTGACCGTGACAGAACAGCTACAGTTGTACGCCAGGATAAAGGGTATCCCGGAAGCTTTCGTCAATAACGCGGTGGATGAGCAGATCCAGGAACTGG
GTCTCACGAAGTACCGCGATAAACTCACTCTGGGTCTCAGTGGTGGCAATAAGCGCAAGGTATCAACAGCCATCGCACTTCTAGGGCGTCCTCGTGTCGT
ATTCCTCGACGAACCGTCGACAGGTGTAGATCCTAGCTCTCGTCGAAAGATGTGGGACATCATCGCACGCGTGTGTTCAACAGATCGCGACGGTAATGCG
AATGAGGGGGCTTGTGTGGTTCTCACCACGCACAGCATGGAGGAGTGCGAGGCACTTTGCTCCCGAGTGGGCATTCTCGTGAGCGGTCGACTGAAATGCC
TCGGCAGTGTTGAGCACCTCAAGCAGAAATTTGGCCGAGGGTATACCGTCGAGATCACTCTGCGTGCTTTGACGAGTGCTTCGAGTGTGGATGATGGCAC
CGAGCTGAAGGATCTTACAGACCAGGTGCTGGCATTCCTTGGTCGTGAAAGAGGTCTGTCAATGCGAGAAAGCGGGAGAATTAGCCAACGACGAAGCtca
gcaagtgctgcaaccAATGACAGATCAATGATCACGTTGACCAATGTACCGGGACTGTGTAGTTCTCTCGGTGCCCCTGATCGTGGAGCTCGTATTCTGG
ACCATACGGGTACGGGCTGGCTGCTGAGCAGTCAACTTAAAGCGCAGGGCGTGCTTTCCGTGGACAGCTTTTGTGCGTGGTGGGTCGCGGAAACTCGCAG
TGAGAGACTCCAGAGCTTCTTTCACGACAAGTTCCCGGGAAGTGCCTTGACAGAACAGCAAGGAGAACACTTCCGCTTCCAGGTACCAAAACAAAGGTTC
GGTACTGCAGATAATGCGCTACGTCCGGCTGAAATTTTCCGTGCTTTAGAGCAGACTCGCACTAGCTTGCACGTGGATGAGTATAGTGTGAGCGAGGCGG
CATTGGAGCATATCTTCAACAATATGGCGGCacagcaggacgaggagaagggCGTGGCCCACGGAATGGTTATGGAGTAG