Transcript Name :
Albla_Nc14000370
Orientation:
(+)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain18.865PS51192
Helicase, C-terminal12.252PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain5SM00487
Helicase, C-terminal1.5SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
Cluster Id
1859
Sequence
        5193 bases(100 bases per row)
ATGAAGACCGTAAATTTAGAGCGCGTGGTGCACGAAGGCGCTCCATTGTTACGTGCAGGCGGAGAGGTAATGAATCCGCGCTTATACTGGTGAGATTTTC
CTTATGCCTCTTGTAGGAGTACAGCTATCAAATTTGTGCCTCTGATGAAGATCGTCGACTTCAGGCGCTAAAGCAAAGGCGAATATTATTGCATCGGGTC
TGCGGTATAGACTCGATTTGGAATACAGGCGAGGACCAACTGGCGATTCAAATGCTACCAAACTTGAACAGAGATCGTGCGTTCAATCCATTATATCAAG
GTTTGGAGCTAATAGTTTCGGGTTCCAGATATTAGAACGCTTGCGTCAGAAATTGAAAAAAGTGAAGAATTTTGTCGGGAAGAGAATGAAAAGAAGGATC
GCTTAGGGGTCGTCAAGCCTTTAAAACGCAAAGCAACAGACCTTTTGCATCTGGACGATGAAAGAAGGCGAAAAGTCGATAGAAAAGCTTTGCGAGTCGA
ATCAAGTGACATCATACTCGAGCATATCGCAAAGCTGGTGACGGATTTGTTTGAATCCATTTTTGACGCTAGATGGGAAATTCGTCATGGGGCTTTTACT
GCTTTACGTCTATTATTCATTCAGCTGACAGCGAAGGAGACTCACTCACCTGGCCCATCAATGAAAGTACCTCAGATCCAGGACGCATGGCTACAAGAAT
GCTTAATCCGGTCCATGTGCGTCTTAGCACTGGATCAATTTGCCGATTATTCCTCTGACTGTTCAGTAGCTCCCGTGCGAGATATTTGTGCTCAGGTTTT
TGGGATCTTGCTGGGGTACTTGAGCGATCATTCTATTTTGTTGGAATACTTCCAAGGTCTACGACACTTGCTTTTAGGAGCAACATGGCATGCTTGGCAC
GGAGGATTACTGGGTCTAAAGTACCTTATCCGAGCTCATCCAGAGAACGCAGAGAGACTCCTTCCTCTTCTGATGAATGACATTCTGGATCCGATGATCA
AGGCAAATGCCGCTCTGAATGGAAATTCGATCCGTGTCGAGGAAGATGTTGTTGCTGTGGCGATAAGTATGTTGGAGGATTCTATCGAGTACTCTGCAAA
CGTCGAGATCGAGAAGCTTGTACGAGCGCTGGAATTATTGTGGAGCCTATTAGCGGGATATCAGAGTCAGTCAGCTAGTATCTTACCAGCAGCGATGGTC
GGAACCTTTAGCGCATGGTTCAATTCTCAGCCATTGAATGAACGCTTAAGACCAAGTATGTCGAGCTTTCCCGCCAGATCGGAGCAACTCGTGCGTCTGA
CTCCATTTCTTCATCATCCAACTACAGCCGTTCGCTTGGCAACCGCAAAATGCTTTATAGCACTTTGCACACTCGAAAAGGAAGGCTTGAGCGAGGAAAG
TGACTTGATGAAATCTCTGCAATCAGCACTCCATTACTGCCTATCCCATCTGCTCCTACAAATACTCCTCGAACGAGATGAAGTTGCTGCAAAGATGGTC
AGTGATGCGTGGAGGAGTCTTCTACGAAGTATCGCCCGCCCTTGCATGGAACCCTCTTCAGATACGGCAGCTGCGTTTCATGGAATTGTAAGTAATCTGG
CAACAGTCTGGCTGGAGATACTTCAAAATACGGCCAACATACACGTTCTAGACATCTTGCCTCCTTCGCTGGATTCTGCTCTGAATGGTGAAGCATCGGC
GTTCTCGTGTACCCGAGATGATGATGGCAGTCTTGTTGCATACGCAGAAGCACTCGGATTCATGGGATCACGATTGTGGACCGAAAGCAGAGCTTACTGC
GCAATGCAAACACATCTTCTTCAAGGACTCTCGTCATTGTCGGGCCAAAGACAGAGCACTTCCCTACTTGTGCTTATGTATTGGGCAGAGTATGCACGAA
AGGATCATGAGTCGAGTTATCTGGACACGCCGAATAAGTCAATGTACAGAGCACTGCGATTCTCCTTCGGCTCCTTGGTTGAGCAACGGGCAAGAGAAGA
GAGAGGCTTTGGTTTTGGATCCCATGAGCACTACCTGAAACGATATCATGCTGCGGATGAATACGATCGAATTGCATTCATAGAAGTGCATGAAATGCTA
CAGCGAGCTTTTCGAATGTGCAAGCGCCTCACGTCGATTTTCCATGCTGCCAATGTTCCAATTCCTCAGTGGAATACATCCAATCCATATATAAATGACA
GCGTCTTATCTGCTGCAAAGTTTTCTCGAGAATTGGCAGAGTTTGCTTCGTCGCTATCATACAATGATCTCGGAAAGAAAGAAGAATATGAGCTGGCACA
TTTCAAAAGGCAGGATCTCTTCACCCTTGATGAAGCGATTCAGCAAGTTTATACCAAATTCTACAATCGTGTGCGTGGCCTGGAATGCTCTGCATATTGT
CGGTTGCTTCCACTTCCGTCGAAAAAGCCTGGGTTTCTCGTGAAAGCTCTCATGAACACGCTGAAATGTGAAGCTTCTCCAGATTATCAAAAGCTAGCCG
CTCAAATCCTGGCTGATTTTATCATCGCTCAATCGGCTGATCAGCGTGGATGTGTTGCCAAGATTGTCGAAAATTTGTGTCATTCGGCCATGTCGGCCAT
TTTCCAAGAAGACGTTGAGTTCAAGAGAGACGATGAAGCCAATACAGCCCTCAACGAGCTCCAGATCAGAATCCGCGGAGCTGAGCAAGCGCTGAGCTTA
ATATGCAAAGGTGCTGGGGCAAACATTTTTGTAGAGCTTCCAAACTTGGAGGCTCTGATCACAGACATGTGGAATGCAGATCTTGACAAAATGTCAAATA
CGGACGTATTTTTACGACAGCGAAGTCATCTGTTGCAATTCTTGACTCAGCATGTTGATGATGGTGCCTTTATTACAATTGTTCCTTGGATCGAAAGCGG
GTTGGCTGGACTACTCTTCTCGCAATCGGTGAAGAACGAAACAAGTCGGATGGCCATTGCCAAGGCAATTGCATCAATTTGTGCTCATTCTACTTCGCCA
AGCCAGGAAACCGCCATCGAATTCGTCTATATGAAGATTTTCTCTGCCGTGGGTGCATCCGTTAGCTCGGATCAGAGCATGCACGGCTATGGTCCTTTCC
GTGAGCACGGTGCAATTGCAGTGCTGCATGCAATTCTTCATAGATTGAAGTCATCCATCACGCCATTTGTTCCAAGTTTGACGCATCTCGCGATGCAGAG
TATGTCATCTCAAGACGAGTCAACTCGAAATCTCGCTACTGCTTCATTTGCAGACCTTGTGCCTCTCATGTCTTTGCAAATGGATTTGGAAATAGCGTCA
TCGAATGATGAAAGCCCACTTGTTGGTGAGATGAGGCAGCTCATTTTGGATCATAATGAGAAATCGCGGACGTTTCTAGAGAGCCTAGTGACCGGGAAAT
GTTTCGAGAAAGAAGATGCGCAGCCTATCTTAGCTTGTGATGCCGTTCTACGAGACTATCAGCAAGACGGGATTAATTGGCTTTCATTTTTGATTCGATA
CAATCTTCATGGAATCTTGGCCGATGACATGGGTCTCGGAAAAACGCTTCAAATGCTTGCTGCAATCGTCTTGTGCTTCCAAAAACTGAGCTCATCGCCA
AACCCTGAACCATTGGTGGCTCTCGTGATTTGTCCACCGATAGTTGCAACCCATTGGGCTTTGGAAGCCAGAAAAAGATTCGCGAATGCTTTTGACGACA
TTATAGAGTATTCTGGTACATCAGCCACACGGCGTCAACTCCGCAAACAACTCGACCCGCATTTCGGGCCCAACAAAAGGTTGATCGTTGCAAGTTATGC
CGTCATTAGGACAGAGATCGAGTACTGGAAGGAGAAATTTTTCACATTTCTCGTCTTGGACGAGGCTCATCTGATCCGCAACACCAAATCCTGTGCCTTC
GCGGCAATGGTCCAACTGCATGCGCGCCATCGATTTGCATTGACAGGTACACCGATTCAGAATCAAGTTGCGGATCTTTGGTCGCTTTTTCAGATTCTGA
TGCCGGGTTACTTGGGTCCCATTGCCAACTTTCGTCGTTCATTTGTGAATCCAATTACACAATCCAGAAATAAGAATGCAAACGCGAAGCAAAAAGAGCT
CGCAGCATTGGCCATAACTCAATTGCATGACAGAGTGAGTCCATTCATCCTTCGACGTACGAAACAGCAAGTGCTGAAAGAGCTACCTCCAAAGATCATT
TCTGATATTCTTGTGCCTGCCACCGCCCTTCAATCCAAATTGTATCAACATATACGACAAGCAGAACTCTCAAACTCCTCGATCCGTCCTCTCCAAACCA
CCAGCTCGCACAAAATAGCAGGTGTCTTCCAGCAGCTCCAGCTTTTGCAGAAAATCTGCATTCATCCAAACTTGATTATATCTTCACAAAAACACCAGCA
TCTAAATCTCTTGGAGCTAGTCGACACCAAAACGCGCAGCTCCATGGCCGATTGGCGTCATTCTGGCAAATTCACAGCCTTGCGAGATCTTTTGCATGAC
GCTTGTGGATTCTCAAGCGATGACAACGATCAGGACGAGACTGAACCAAGCTTATCCCCAACTCATCGATGTTTGATCTTTTCTCACTTGCAAGAGACGT
TGGATTATGTGGAGCATATGTTTGAAGAATGCTTCCCTCGCCTCACATACACACGACTTCGAAGCACTTTAACGAATTCTGTGTTCCACGAAAAGTGTCG
AAATTTTAACGAGGATCCATCCATTGATATCTTGTTATTGACAACGTCGATCGGTGGCCTTGGATTGACACTGACTGGCGCGGATACCGTCATTTTCCTG
GAGCACTCGTGGAATCCTTTTGTAGATTTACAGGCGATGGATCGAGCACATCGACTCGGGCAGACCAAGTCCGTCCGTGTCTTCCGTTTGATTATGCAGA
ATACTTTGGAAGAAGAGATTTTGAACCTGCAGTCGTTCAAACAGCAAGTTGCTTCCAGCGTTATCGCAGATGCTTCACATACACAACAACACAATTACGA
TATTCTTAGTCTGCTGCGCAATGCAAACGCAGAACACATCTCGTCCGATTGTGTAAAAGAAGGAGGTACACTTACTGATGCAGAGACGGACGGGTTGCCA
CGTAATTTGCAGAAAATGGTGCAAGAGCTTGGTGCTCTATGGGATGAATCGCAATACAAAGCACTTGATTTCCCACTGAAAAAAGCATCCTGA