Transcript Name :
Phyin_T30-4PITG_03393
Orientation:
(+)
Number of Exons:
5
Description :
Autophagy-related protein 8
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-116
NN-scoreoddsWeighted Score
0.7663.5910.007
*** None ***
TypeScore
nuclear565
GO
*** None ***
KO ID
K08341
K08341
K08341
Cluster Id
4903
Sequence
        1234 bases(100 bases per row)
GGAAGCCGAGAAGAAACGTCGAAGGCAAGTAACCCGATCGAAGCCAATGGTGGTGGCGCTCGAGCTCGCTACGCTGAGCCGCCTAGGCCCCGCTACACAT
CTTTACGTGTGTGTTTTAGTGGTTGACGTGCAGCAGAAACCCGCGTCTCTCGATTCGATCTACGGAACGAGAACGCGCGAGTGAAGCTGGATCATCCCAC
TCGGGAGTCAGGCGGTGGCTTCCAGTGTCTAATGGGGTCGCAGCACCAATTTGGCGCTCAAATAGTGTGCAGCGACCCTTCGTGGTGGGAAAGTGACTAA
CTGTGTTCTGCTATTGACCTGGCGCAGACGAACTGAACTCGGAATCTAGTTACCAAGAAAGGAAGCAGCACACCATGAGCTCATTTAAGAAGGAACACCC
GTTCGGTAAGTGGCCGTTTATGTCTCCAGTTTGCTGTGGCAATCGCTGAAGGCAATTTTTGGTGTCAATTTTGTAGAGAAGCGCCAAGCCGAGGCTCAGC
GTATCAGATCCAAGTACCCCGACCGAATTCCGGTATGTAGCGTTGACAAAAATAATTGGTTAATGTGTTAGCTGACGGATTAATTTACTCCTGGCGCAGG
TGATTTGTGAGAAAGCAGACCGAAGCGATATCCCGGACATTGACAAGAAGAAATACCTGGTGCCAGCCGACCTAACAGTTGGCCAGTTCGTGTACGTGAT
CAGAAAGCGCATCAAACTGAGCCCCGAAAAGGCAATCTTCATCTTCATCAACAACGTCCTCCCACCTACCGGTACGCCTTCTCCGCTTCATCATTTTTTA
GTGAATACCATTTGTTTACTCACATCGCTGCGCTATTTTTCTCGTTCAGCTGCTTTGATGTCGAACATTTACGAAGAACAGAAAGATGTGGACGGTTTTC
TCTACATCACTTACAGCGGCGAGAACACGTTCGGTCAATAGGTTGCACGTGCTGTGCTCGTGTGGGGACTGGATTTTGGTTGAACGAGATTTTTTCGTCG
TCGCTTTAGGGAATTGCGAGGTTCGAGCTTTCTTGTTGCAGTAGCGGCGCTGTACTGTTGACTTCAGTAGGAACTGATGGCAAGATGAAGCCGCCGGAAT
CTACTTCAAGCATGGAAAGAAGTACTACTACATGTAGTATTTGCTGCGGTGTGGCTATTTCTACTAGAGCTGGCGATGTGGATCTTTCTTAGGAGCAAAA
AAAACAGAAAAATGCATTCAATTCTATTCTCTCT