Transcript Name :
Phyin_T30-4PITG_03482
Orientation:
(+)
Number of Exons:
7
Description :
Putative uncharacterized protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Sel1-like0.011SM00671
Sel1-like1.5SM00671
Sel1-like0.082SM00671
Sel1-like11SM00671
Sel1-like1.3SM00671
Sel1-like8.4SM00671
Sel1-like3.1SM00671
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Sel1-likeIPR006597
*** None ***
InsideOutsideTMhelix
1-618
NN-scoreoddsWeighted Score
0.5171.1460.002
*** None ***
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        2693 bases(100 bases per row)
ATGTCGCCGACTGGAACAGCTAGTGAAACTGTGACGGGGCAGGAGGATGCTGCTGTCAAGAAAACTGAAGCACTGTCGAACTCGAAGCCACGTGAGCCAA
AGTTGCTTTTCGCTGTAGCGAAGAATGTTGTGACAGCGTCCAACGCTGCGCGGTCGAAGAAACAGTCCCCAACTAGTATCAAAAGCCCCGAGGCCGCAAC
GGGAGAAGCAACTGGGAGCAAGCGAACCATGTTTGGGATCATCAAGCGAGCTCAGACGAGTGAAGCTCAACTGCAGCAACAGCAACAATCATCGGAAGAG
AATCGACAGCAAACAAGCAATCGAGAATCAAAATCTGAACAGGATTTGAAACAATCTTCTTTGTCGATCGAGACTGAGGACCACACCAGGTCGGATATCA
GCTTCGTAGATGTCGTGCGAGAAATTTTGGAGAAACTGGTGACACAACTGGACAGTGTCGATCCCCGCAAATTGCTTGCTGTACGGCTAGGAGGAGAGCT
TCGAGGCTTGTTGGGCAAAGCACAAGATGAATTCGCAGCATACGAGACTGAATTTGTGGAACATGCAGACAACGAAGGCGTCTCAGTCGCCCTACAGAAC
TTTTTAGCCTCACTGACTCAAGTTTCTGCTATCGCGGAGCGACTTCGCACTGCAAAATTTATGCTGAACCGAACTTTCAAGCGTGAGGTGTTGTTTGCCT
TCCAGGAGATCAATTCATATTATACGTCACTCTTTATGGAGCTGTCGATGGCAGTAGCTCGACGGTCAGGAATTCATTTGCCACTCCCTCAACCTGTATC
ACCACCAGAACCACACGCACCAACAGGGGATGAAATCTGCTTGGAAGCTCATCAGTACTATTTTGGACACGGGGTGGCAAAAAATCTTCGCAAAGCTGTT
GAGCTCTACACAGTAAGCTCTTGGCGCTTCTTGACAACAAGTTACACTTCCTTGCAGTCTAACGTGACGGTGTTACATATACGCAGCAAGCTGCTAATCT
CCATTGTGCAGTAGCCATGACGTGCTTGGGTCAAATGCATTTTGCTGGGAACGGAACCGAGAAAGACTTGCTTGTCGCCGAAAAATGGCTTGAACTTGCA
TCATCGGCAGGCGACATCGAAGCCTGCTACCAACTGGGTCTTTTGATGGTAAACAGCAATGGTTTCTTGTACTATGATCAACTTGAACGTATTCTGATGT
GGTATGCGCGTTATTCCCAACGTCAGTGCGAGAAAGAGGCCCATGTGAACGACCCACAGCAATCGGACGAGTTTCTTTCCCTTGCTCGGGTTCGCTTTAC
CCAGGCGGCGGGGCAAGGCCACCGTGATGCGCAGTACGAGTTAGGTAAACTGTGTCCAAGTATCCCTCTTTGAAATTCTTCGTAGCAATACTCATCAATA
CACTGGGCTGCATGATAGGTGTTTTTCACGAGACTGGACGAGGCGGCGGGTGTGAGCCAAACGAAAGCGAAGCAGCAACGTGGTACACGAAAGCAGCGGA
CCAGGGCCACACTGCCGCCGAGGCAAGTCTTGGCCGTCTTTTTCTTATTGGGACGCAGATTCGGCAGGATATTGCCAAAGCTGTTCACTTCTTGCAGCGC
GCGGCTGCAAAGGTGAGTTCCGGCCATGTAAATCGAGTATCTGGTTCATTTTCTAAACTCGTGATCTTCTTTAACCCACCAGAGCGATTCAAACGCCCAG
ACTAGGCTAGGCTTGCTGTACACCACAGGAAATGGTGTCAAGCAAGATATGGAGCGTGGGGTGGCATTTCTGCAAAGCGCAAGTTCTCTCACTGCTCATG
TCGGCCATTTTGTGCTCGTGCTAAATTGGTAATGATTTCGTTTTTAGGCTGCAGATGCTGGTAGCAGCGTTGCCATGACGCGACTTGCAAGCTTGCTGCT
TCTCCACACACCTCAACAGAATGGAGCACTGACAGCAACGAATGGATCGTCTTCATCTGCTCAATTTCAAGACCGTGAGGAGGCACACGACGAAGCCCTG
CGCTTACTCTTGAGTGCTGGACATGGTGGACATACTGAGGCTTACTACGCACTTGGCAAACTGCTCGAGACCTCGTCGCTACTTCGGGACCAATCTGCAG
CCCTTCGCTTTTACTCGAAAGCTGCCACTGCAACAACGGTGAGCAGCAATTTGGAAAATTGCGCCAACTACTCCAACTTGTCCACTAATTGTGCCTTTGT
AGCCTCACACGAAAGCCGCAAAGCGTGTAGCCACAATGTACTACTCGGCTATAGGCAGCAAAACGGATAAATGGAAGGCACATCGATTCTATACCATCGC
AGCAAACGCCGGCGACGCAGAAGCCTTGAACGCGCTTGGTACGACTGTGTTTATCCACCGACTTCATCACATCCCTCATCGACGCGCGATTCTGACTTGT
TGCAAATTGAACAGGTCTCATGTACGAAGAAGGCGACGGCTGCGATTTGAATTTCCGAAAAGCTGCCGAATGCTACCGCACCGCTGCAGACCTGAATAGC
CCGCATGCCCACTTCAACTTGGGCTGTCTTTTTGCAAATGGCAAAGGCGTCGCTCGTAATGTAGATGCTGCACAAGCGCATTTCCGGAAGGTGCGTTGAC
TGACATACTTCCAACTTCAATGGATATTTTACAACTCGAATTTTGCAGGCCGTAGAGCTTGGCTACTCATTGGCACAGCAGTTTGTAGCTTGA