Transcript Name :
Phyin_T30-4PITG_03293
Orientation:
(+)
Number of Exons:
3
Description :
Ser/thr protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain42.35PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4.2SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-419
NN-scoreoddsWeighted Score
0.7353.0650.006
*** None ***
TypeScore
nuclear391
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        1435 bases(100 bases per row)
ATGAATCGCTATGAGATATTGGACAAGGTCGGTGATGGGGCGTTTGGTGAAGTTTCGCGTGCTCGGAGCCTTAAGACCAAGGAAATTGTAGCTGTGAAGA
AGATCAAGGCACTATTTCCCACATGGGAAGAATGTCTTCAATTGCGTGAGCTCAAGTCGCTTCGAATACTACGCCACGAAAACATTGTGCTACTGAAAGA
GGTTATTCGAGACAAGGAGGAGCTCTACTTCGTGTTCGAGTACCTACAGACGTCGCTTTTTCTGGTTATGCGTAACTTCAAAATCTCATGGAGGAGGCAA
CAACTACGCTGGCGTTGGAAATGACTCCAGCTCAACCTCAGACTCTTCCACTTCTCATCCCTGGTTTTCGGAGGTGCAAATACGCTCGATTATGTTCCAG
CTCTTCAGTGGCCTAGCATACATGCACAAGCACGGCTTCTTCCACCGTGACATCAAGCCTGAAAACTTGCTATGTCACGAAGATACGCTCAAGATTGCAG
ACCTGGGTCAAGCTCGCGAGATCCGATCACGGCCGCCTTTTACCGACTACGTTGCAACGCGATGGTACCGGGCACCTGAGCTGTTGCTACGCTCGACGAC
ATACAATAGCCCCATCGATATGTGGGCCTGCGGGTGTATCCTTGTTGAGCTGCTGATCTGCACGCCGCTGTTTCCTGGAACGTCTGAAGCGGATCAATTC
TATCGAATCTGCAAAGTTCTTGGTACTCCTACGACGGAAACATGGCCCAAGGGTGCAGCAATGGCTTCCCATATGCAAGCTCGATTCCCTAAGTGCACTC
CCGTGTCTTGGAAGCGAATCCTGCCGTCAGGTACACCGTCTTCAGCTGTTCAGCTTGTACGAGATCTGCTACAATACGATCCAAGTCGACGGATTACAGC
AGCGCAAGCCCTTCAACACCGCTTTTTCGATCAAGCTATGCCAAGACCAACGCTAACAATACCTCCATTAGTAACACCAGTGCAAGAAGTGCCCGTGTTG
CCGCTTCGGAGCGATTTCAAGTCTGGAGGAGGCTACTCGAGTTATACAGGACGGTCAAGTGTCTGTGCGAAGAAGTCGGACGACGTGGAGCATTGGGCAG
GAGGGTTATCGTCACGACAAGAACACCACTTGTTGACTGCCAATAAAAGACAGCAGACTCATTCGCGGCACCAGGACTGGGGCTCTTCTCTTGTTAGTGC
TCGCCCTGGTGGATATGACGACGTAGCTGACATGAAAACTGTTTCGCCTATACAAAATGGAGGTGGAAGTGGCATCTCCAAAGGAGGCTCCATAAAGAAG
AGCTGCAGCTACAACGCGCTTGTAAGTGAAGGTGCCACTAGGAAAATTACATCGGAAGACAACAGCGAACACGATGACGACACTAAAAGTGATAGCACAT
TACTACAAGACCTGCTTGATGAGATTCTAGGATAA