Transcript Name :
Phyin_T30-4PITG_02526
Orientation:
(-)
Number of Exons:
2
Description :
Dynein heavy chain
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.26SM00382
AAA+ ATPase domain2.9SM00382
AAA+ ATPase domain0.27SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
KO ID
K10413
K10413
K10413
Cluster Id
6
Sequence
        14109 bases(100 bases per row)
ATGGCGAGCAGCGCGGACGTGACGGCGCCGGCCGCCGACGTGCTGCCTGTGGTCGATTTTCCGCGCTACCTATTGTCCACGTGCATGCCGCTCTTTGGTG
AGGGCTCGGCGCTAAGTGTTGACAGCTTTAAAGCTGACCTCGCCAGTGCGGAATCGACCAACACTCTGCACCAGTTTGTGTCGGACTCAGCCACGCGCGT
GCTGCAGGTCCATTGCTTGCCCGCACGCGCCGATGAGGACAGTCCCATGGACGGCTCCACATTCCGAGTACGCGTGAACGTGGGCATCGAGTATTCCCCA
GGAAAGAAGAACGGGCACGACGTAGTGTGCTTCATTAAGCGCTTCAGCGCTCCACTGGCCAAGGACCAGACGCTCAACCACCAGCTGCAGGTTATGACAC
TCGGGCTTGGTAGTAAGGAAGTGGACAAAACGGACTCGGACACAGCTACCAGTAGCAGCGGCGAGAACACTGAGGAAGGGGTTGAGGACAGAGGCAACCT
GCTCTCTGTCGTGTACAACTACGTACACCAATCATTCACGCCGCTCGTAAACGAGTACTCGAAAGTGCACATGCCGCAGAGCGAGATAACGAATCTAAGC
GAAGGCACGAGAGGTCTGCCAGCCATTCGACGCAGGATGAAGGAGTTGGAGCTGGCCCTGCTCCAATATCAACAGAATATCGAGATCCCAGAGGTGAACC
TCGTCTTCCACCCTGTGATTCAGCAGGCGGCTGATCTCGTCCGTACTAAAGGCGTGTTGATTGATGTGGAAGCGCTGGGACTGGAAGACAAGGTGAACGA
CGTGACCTTCGTCAATACCATCCAGGGAGGCGTAAGCAAGTGGATCAAGGAGATCCAGAAAGTCACACGTCTCGTGAACGAGCCATTGCCTGGAACTGCC
ATGCAGGAGATCAACTTTTGGTGCGATTTGAACCGCGCTTTACTGGCTGTTCAAGAGAAACTCAAGTCGCCCGAGGTTGAGATCACTTTGGCTGTGTTGC
AGCGAGCCAAGAGATACCTGGCTACAGTTTCTTTCAGCACTGACCACGGCTTAAGTCCAGCGCTTCAACAGGTGTCTAGTGTCATGACACTTATGAAGGA
GTTCCCCATGAACTCCATTTTATCGGCCACAGATATCAGCCAGCTGAATCAGGGCGTAACGCTGGTGTTTACTCATTTGAAGAAGATCCGCGTGGCCGAC
TCGTACAACCTGTCGCGTCTACTGCATTTGGTGGAAGTCATGTCAAGTGATTTAACGCAGCAGGTGATCAGTCTGCTGCGTGTCTACAGTCTCATTGAGA
TCCCGTTCAACCAGTTCGAGCAGCTGGTTTCGTCGTGCAAGGAGCTTTTCACCAACTGGCATCGTCAGGTCACAGCGCTCTATGACCTCACCAAGGAGCT
CTTCAAGCGACGAGGTGGGTCGATCAACACGATAAAGCTGCCGCTGCTTTCGGAGCTGCAGATGGAGCACGTTGCGATCGAAGAGCGATTGCTGGAGCTG
TACGAGTTTCGAGAGCAACACAAGAAGTTGAGTGATGTGATTCAGAGAGTGCTGGGTGGGTCGAACGCCATTGGACTGGACGAGGCTCGTGGCGATGGCA
CGAACGATGCGCTGGCCGAAATCAACTCGGCGTACGCCCAATTGAATTCGCTGGATCCTCTTGATGTTTCCGTGGAAGGTGTGACTGCGTGGAAGAACCT
CCGCAAGGCGTATGATCTGTGCATTGATCGCGTTGAAGGACGAATCATTAACAGCCTTACCAGTCGGCTGAGTGCTACTTCGAACGCCGACGAGATGTTC
CGTGTATTCTCCAAGTACAATGCGCTGTTTTTCCGCCCTCGTATTCGCAGTGCTGTGCAACAATTTCAGATGCAGCTGATTGAGAATGTCAAGGAGGATG
TGAGCAACCTCCAGGCCAAGTTCCGTGCCCACTATGCCTACTCTGAGGCCTCGCGCACAAGCAAACTGCGCGATATTCCACCTATTGCTGGTGCGGTGAT
GTGGGCGAAGCAAATCGAACGCAAGCTGAAAATGCTGCTGTCTCGTGTTGAGAGTGTACTTGGCGTTGGTTGGGAGCAGCACGTGGAGGGTAAGGCGCTA
AAGGCAGCGGCTGAGGCGTTTATTGCTAAACTGAACCCGCAGCTTATCTTCGACCAGTGGGTGAACGATTTGGCGTCCATGCCGATCTTCGACATCAAAA
ATATCATTCTAAATATCGTGACGGAAGATACGCCGCAGGGCGAGAAGAAAAAGTTGGTGGTAGCATTCAACCAGCAGATTGTGACGTTGTTCAAGGAAGT
GCGAAACCTCGAGTGGCTGGGCTACCGTGTGCCTTTCACGCTCAAGATGATTGCTGAAGATGCCAAGTCAAAGTACCCGTTTGCAATGTCTTTGGACGCT
AGTCTCAAGACGTACACAAGCTCGTGTCGACGCATCCAGCCCATTTTCGAAACGTTAACGGCTGCATATGTGCGTGAAGTTCGCGCTACCATTGGCAAGA
CGTTTACGAAGGGCAATGAAATGCGATGGCATGCCGATGGATTGGGTGAGTACGTTACGGACCTTGCTACGAAGGTGGAGCGTCTACATGACAAGGTGGA
TGAGCTGCTGCAGAAGACTAGTGAGATCGATTCTCTTTTGGAAAGTGTCCGTACCAGTTCCGACTTCCAGGCTGGAGATGCGCAAGCTGTGTTGGCGAAA
GTTCAAACGCATGTCGACGAGTTGAGCTTGGCTGGATATGCGAACCTGCACGTGTTTGTGAAGAACCTGAACACTGTGATTAGTGAGATGCTGGGCAAGA
AGCTCGAGGTGATTTTGCAGCGCTGGGTTGCATGCTTTGGTCCTCAGCCCGACGACAAGGCGTTCGAAGCTGCTCTTGCTGAGGCCGGACTTACTGTTAC
GACCCACCAGATCCTACTCAAGAACCAAGTTTTGTATTTGGAGCCTTCGGTTGGCGACGCGCGTCGGGATTGGCTTGCTCAGCTTCAGAATTTACTGAAC
TCTGTGTGTGATCTGCCCAAGATTCAGACGTCATCGTATGAAAATGTGTATGGAAAGTCGACTGTGTTGGCGTTATCGTCGCCGCCCCGAAAGAGCGCCA
GCTCTAGACGACGCGAGGCTGTGTTCAAGGAAGCACTGAACAAAGTTCCCCTCGACTTGCTGATCAAAGCGTACAGTGTGCTGGATGTCACTGTGAGTGA
TGTGGATAAGTGTGCGTCAACGTGGCTTCAATACCAAGCGCTGTGGGATATGGACGCCCAGACTGCTTTGAACAGTGTTGGAGAAGATCTTCGGAAGTGG
CAGCAGATTTTAGTGGAGATCAAAAATGAGCGCAATGCGTTTGATGCCGTCTTCAACACAAAGCGATTCGGCCCAATGGTCATTAACTACCAGCAAGTGC
AAGCGCAAGTGAATGTGAAGTATGACGCATGGCACAATGAGTTCCTCGCCTACTTCGGTGACCTTCTTCGCGACCAAATCAACTCGTTCTATTCAACCAT
TTCGTCCAAGCGTACACTTCTGGAGCAACACGCACTTGAAGCTGCCACTGCGCAAGTCGTTGCTGCCATCACGCTAATCCAAGAGATGCGTCAGATGCGC
GTTCAATGGGAAGAAGCAGTCGAGTCGTTTGAACAGGGCGAGCGCTTGCTGAAGAAGCAGCGATACAGATTCTCGGCAGATTGGCCGTCGCTGGCGAATG
TGGAAGGAGAGTGGGAAGCTTTCATTCAGCTGCTTGAGCGAAAGACTGCTGCGATGGAAAGTCAGTTGCCTCAGCTGCAGGCTAAGATCATGGAAGAGAA
GAGCACACTGGACAGCAAGATCAACAAGGCCGTGGCTGAATGGGACAGCTCCAAACCACTGCAAGGTGGACAATCGCCAAAGGCAGCCACAGAAACGCTT
ATTGTGTTCGATACGCGCTTCAAGATGCTGCGTGCTGAACAAGATAAGACGAATGCAGCGTTGAATGCCTTGAACATCTCGTATGTGTCGGGAATGGGTG
GCTCTTCAATCGACGATGACCGCACTTCGTACGGTGATCTATCGAGAGCTATGGAGGAGTTAGCCGGTCTGGATGAGGTCTGGAAGAGCATTTCGAAGGT
CTGGGCTCAAGTTGATGAGCTGCAAGATACGCTGTGGTCTGCAGTTCACCCTCGCAAAGTCCGCAAGCAACTCGATGAAATTGTCGATGAGATGCGCCGC
TTCCCTGCCCGAGTGCAGCAGTACGAAGCCTTTGAACATTACACGTCGGTGATTCAGGCGCGTAAGGCCATGAATTCTCTGTTATCGGAGCTGAAGTCAG
ATGCCGTTCGTGACCGCCACTGGAAGCAGATCCTGCGACTGCTGAACATCTCGTCTCCTTTGACAGAGTTGACCCTACGCAGTTTCTGGGAATCTAAGAT
CTCCACCAACGACAATGAGCTCAAGTCGATTATTCGTACTGCTCAAGGCGAGATGGCACTGGACGAGTTTCTCCGCCAAGTTTCCGACTACTGGACTAAC
TATCAGCTGGACCTGGTCAACTACCAAAACCGCTGCCGTGTCATTCGCGGTTGGGACGAGATGTTTGCCAAGCTAGACGAACATCTCAACAGCTTAAGCA
GTATGAAGCAGTCTCCGTACTATCGCGTGTTTGCTGAGCTAGCGACGAGTTGGGAAGACAAACTCACGAGGATTCGTAGCATCCTGGACTTCTGGATCGA
CGTTCAACGACGCTGGGTGTACCTCGAAGGCATCTTTTTTGGATCGGCAGATATTAAGCAGCAGTTGCCGAAGGAATTCGCACGTTTCCAAAGTGTGGAC
AATGAGTTCACGTCGACAATGAAGCGCGTTGCGCACAAGCCAATGATCGTGGATGTTGCCAACATCCCGAACTTGTATCACTCGCTTGAACGTCAGCAAG
ACATGATGGGTAACGTCCAGCGTGCTCTGGGTGAATACTTGGAGCGCCAGCGTGCTGCTTTCCCTCGCTTTTACTTCGTAGGCGACGAAGACTTGCTGGA
AATGATCGGTAACAGCAAAGAGCCGATGCAGATTCAGCGTCATCTTTCGAAGATGTTTGCTGGCATTTCTTCGTTGGAGATGGACAACAACACCGGTGTG
CTTCTGGGAATGGCGTCTCGTGAAGGAGAAGTCGTCCACTTCAAGGAACCTGTGAAGACGAGTGAAGATACCCGCATCAACGTGTGGTTGGGTAAGGTGG
AAGAGCAGATGCGTAAAACATTATCTCTTCTTCTAGAAGAAGCCGTGCGTTCGTACCCGACAGATGACAATGCTGAGGCGTATCTGAAATGGGTGTCCGA
GTTCCCGGCTCAAGTGATCATTCTTGCTACCCAAGTGCAGTGGTCAAACGAAGTCGAAGGCGTCTTGAAGGCTGGAGGTGACAAACTACCGGCGGTTACT
GAACAGCTGGATAAGCTGCTTCTCATTTTGAGTGAACGCGTTCTGACGGATGTGAAAAACGACGTTCGGAAAAAGTATGAGCAGCTGATCACGGAGCTTG
TGCATCAGAAGAGCGTCACCAAGCGTTTGAGTCAGGCCAAGGTGAGCAGTGCAGAGGACTTCCGTTGGCTGTATCACATGCGTCACTACTTCCAAGCCAA
GGAGTCCGATCCGCTCAAGAAACTCACTATCCAGATTTCCAACGCCAGTTTCTCGTATGGATTCGAGTACTTCGGCGTCGGCGAAAGACTTGTGCAGACC
CCTCTTACGGAGCGTTGTTACCTCACATTGACGCAAGCGCTAGACTTCGGAATGGGTGGAAACCCGTTCGGTCCTGCCGGCACAGGTAAGACAGAGTCCG
TTAAGGCTCTGGGATCTCACCTGGGTCGCTTTGTATTGGTCTTCAATTGTGACGAGCACTTCGACTTCCAAGCGATGGGTCGTATTTTTGTTGGTTTGTG
TCAAGTTGGCGCATGGGGATGTTTCGATGAGTTTAACCGTCTCGAGGAGCGTGTGCTTTCTGCCGTCTCTCAACAGATTTTGGCGATCCAGAGTGGAGTG
TCTTCGTTGAAGGTCGGCAAGGCAGCGAACAACACGCAGGCTCTTACAAAAAGCAGCAGCTCCACCGCTACCATCGAGTTGCTGGGCAAGAGCGTCAAGC
TGAACCCCGATGTGGGTATATTTGTGACGATGAACCCTGGTTACGCTGGACGATCGAACCTACCGGACAACTTGAAGCAACTGTTCCGCAGCATCGCAAT
GGTTGCCCCGGACCGCGAATTGATCGCACAAGTGATGCTTTTCTCGCAGGGTATTACCACAGCTGAACAGATCTCGGCCAAGGTTGTGCTCTTGTTCAAC
CTATGCGAGGACCAGCTCTCGAAGCAGCCTCATTATGATTTCGGACTTCGCGCTTTGAAGAGCGTGCTTGTAAGTGCTGGTCAGCTCAAGCGCAAGATCA
CCCAGTCGCAAGAAAGTGCGGCGCCTGCAAGCATTGAGGAGCTGGAAACGAAGGCGCTGATCGGCTCTATTACTGACACAATTTTGCCCAAGCTCGTTTC
CAACGATGTTCCTGTATTTGAGACGCTTCTGAAGGGCGTTTTCCCGGGCACGGAAGCGCATCGTATCGAGGAAGACGACCTCCGCGCTCGGATTATTGAA
CTGGCAAAGAAAAACAATTACGTTGCGAATGATCAGTGGGTGGAGAAGGCGTTGCAGCTCTACCAGGTAATGCAGCTTCGTCACGGTGTGATGCTTGTGG
GCGCTTCTGGAGCTGGAAAGTCGAGCGCGTGGCGTGTGCTGATGAACGCCATGGAGCTTGTTGATGGTGTGAAGGGTGAAGCTCATGTGATTGATCCCAA
GGCGTTATCGAAGGAGCATCTGTACGGTGTTCTTGATAACACGACGCTTGAGTGGACGGACGGTGTGTTCACCCACTTGCTCCGACAGGTGCTTAACAGC
GTAAGAGGTGAAAGCGAAAAGCGACACTGGATCATTTTCGACGGCGACGTGGGTCCAGAATGGGCTGAGAACTTGAACTCTGTGTTGGATGACAACCGCC
TGTTGACGCTCCCGTCAGGCGAACGTCTCGAGATCCCGCCGAATGTGTGGATCATGATGGAGACGGAGACTCTGCGCTACGCCACACTAGCAACTGTCAG
TCGCTGCGGCATGGTTTGGTTCTCGCATGACACAGTCAAGACGTGTCATATTGTCGAGCACTATCTACTGAAAATGCGGGATGACGTGTCTGTTGTGTCC
TCGTTCTCGCTCCAGCCGAGTGAAAGTGAGCTGGCAAAGAAGACTGCGCACACCTATGTCGCTCTTCTCCGAGATCTGATTAACCGTGGAGATGGCATGA
CCTCGCTGATCGAGATTTGCTTGGAGCAGGCAATGGGCCAAGTGCACATCATGGAGGTCACGGCGCTGCGTCTGCTAATGTCGATGTTTACATTACTTGG
ACGCGGTTTGTCGCGCATCAACGAGTACAACGAAGGCCACTCAGACTTCCCAATGACGATGGAGCAGATGTCACGCTTTGTGCCGAAGTGGTTTGTGTTC
TCTGTTTTGTGGGGCTTCGGAGGCTCCATGGACTCGACCAACCGCATGATTTTGTGCGATTTCGTGGTGCAAACGCTAGAAAACCGTTTGGTGTTCCCTG
TTGCTGCGTCGTCCAGTCCGGACAACGGTCTGCTTGAGTACGAAGTTAACATCGATGATGGTGAATGGCGCCAGTGGCTGCGATCGATTCCGCAGCTGGA
TCTTGAGAGCCACCAAGTCTTGTCGACTGATGTTGTGGTGACAACAGTGGATACGATTCGTCACGTCGAAGTGCTGCGAGGATGGCTCTCGCAGCATCGT
CCACTCATCCTCTGTGGCCCACCTGGTAGTGGTAAAACGATGACGTTGACGTCCACGATCAACTCACTCCCTGAGTTCGAATTCGCGTCTCTTAACTTCT
CGTCTGGTACCTCACCCGATCTAATCTTGAAGACGTTCTCGCAGTATTGCGAGTACAAGCGCACACCCAATGGAATGTTGTTAGCGCCTAACGCACCGGA
GAAATGGCTCGTCGTGTTCTGTGATGAGGTCAACCTCCCGGAGGCTGACAAATATGGAACACAGCGCGTGATTACGTTCTTGAGACAGCTGATCGAGCAA
GGAGGCTTTTGGCTGGGCGGAAAGAACACTTGGGTGCGGTTGGAACGCATTCAGTTCGTCGGTGCCTGTAACCCGCCGACGGATCCAGGCCGTGTACCGA
TTTCTCTGCGTCTACTGCGTCACGCGCCTGTGCTTCTGGTCGATTTCCCGTCGTATCCTTCGCTGAAGCAGATTTACGGAACATTCAACCGTGCTTTACT
GAAGCTGACGCCATCGCTGCGGTCGTACGTGCAGCCGCTTACTGATGCCATGGTTGACGTCTACGATAACAACCAGAAGAAGTTCACGGCGGAGATGCAG
CCGCACTACATCTACAGTCCTCGAGAGCTCTCGAGGTGGATGCGTGCGCTGTACGAAGCTATTGAGCCGCTGGAGTACGAAATCGACATTGAGACTCTCG
TCAAGCTGGTCTTCCACGAAGCCCTAAGACTTTTCATGGATCGCTTGGTGACGTCTGATGAGCAGAAGTGGTGCTTCCACATGGTGAAGGAGACGTTGAG
GAACCACTTCCCTCAAAGTGCTACTGCTTTGGAGGTGGTGGAGTACGGCGGCCAACACCCGATTCTGTTCAGCACGTGGCTGTCCAAGAACTACACTGAA
GTCACGACGACGGATCTTCGCAAGCACATTGAAGCTCGCTTGCGCGTCTTCTACGAAGAAGAGCTAAACGTCCAGCTTGTGGTTTTCGACTCGGTTATCG
ACCATGTTCTTCGCATTGATCGCGTGCTTCGTCAACCGCTTGGTCACTTGCTGCTTGTTGGAGAAAGTGGCGCAGGAAAGACGGTGTTGTCCCGTTTCGT
GAGCTGGATGAACGGCATGTCCGTGTTCCAGATCAAGTTGACCTCGAATTACACTCTGGACAACTTTGATGACGACCTCCGAGTTGTGCTGAAGCGATGT
GGCTGTGAAGCTGAGAAGATTTGCTTCATCTTTGACGAGTCCAACGTGCTGGATTCTGCTTTCTTGGAACGCATGAATGCTCTGCTTGCATCGGGCGAAG
TGCCCGGTTTGTTCGAGGATGACGAGTACACGTCACTTATGCATGCTTGCCGAGAAGCTGTACAGCGTGATGGTGTCATTGTGGAGAATACGGAGGACGA
ACTGTTCCGATACTTTACGAAGCAGGTGCAGCGAAACCTTCACGTGGTGTTCACCATGAACCCAGCGTCAGGTGACTTCCAGAACCGTACCAATACGTCC
CCTGCTCTCTTCAATCGATGCGTGGTCGACTGGTTCGGTACATGGAATGATCACGCGCTCGCACAAGTGGCGTACGAGTTTACGAACACGCTGGATCTTG
CTGGGTCCTCGGGCTTTATTATCCTTGGTGATGCTGCTGCGGTCTTGACGAAACTGATCCCGCATATTGCCACGGGAACGTTCCGTGACGTTCTGGTTGG
GAGCATTGTTCAGTTCCACCATGCCGTCTTGCTTCACATGCGGCGTCTCCAGAAGCGCCACATGAAGTACAACCACATTTCTCCTAGAGACTACCTGGAA
TTCATCCGTCACTTCGTGTCGCTGTATTCGGAGAAGCGTGCGCAGCTGGAGGACCAGCAGCTTCACTTAAATGTCGGCGTGCAAAAGCTACAGGCTACGC
ATGAGCAGGTAGCGGAGCTGCAGGGACAGCTCAGTCTGAAGGAGAAGGAGCTCAAGAAGAAAGATGTGGAAGCCAACGAGAAGCTTCAGCAGATGGTGCA
GGAGCAGAACGAGGCTCAAGAGAAGAAGAAGGATACTGAGGCCCTCGCGGCTGATCTTGCGAGCAAGGACGAAGAGATCCGTTCACGGAAGGAAGTTGTC
GAGGCAGACCTTGCGCAGGCTGAACCGGCACTTCTGGATGCTCAGGCGTCCGTGAACTCGATTCGTAAGGCTCAGCTTGATGAGATCCGAGCACTCGCGC
GTCCTCCTGCTGCCGTCCGAATGACGATGGAGGCAGTAGCGGTGATGCTGGGCGAGTCGAGCTTGGAATGGGCTGACTTGCGTAAGTTTATTCGCAAAGA
CGACTTCATCTCGCAGGTTGTCAACTTTGACTCGGAGAAGCTGACAGCTCGCCAACGACACACTATCCAGGCGAACTACGTGGACAAGGTTGATGAGTTC
GACTACGAAAAGGTGAATCGTGCGTCGAAGGCGTGCGGTCCGTTGTACAAGTGGATTGTGTCGCAGCTCAGCTACACCAACATTCTGCACAAGATCCAAC
CGCTGCGAGACGAAGTGCAGACGCTGATTGACACGTCGTCGGATCTGCGCGAGAGGTACGAACAGGCCAAAAAGACCATTGACGCGCTCGAGATTCGCAT
TGAAAACTTCAAGCACGAGTATGCGGCATTGATCAACGAGGCGCAGATTATCACGAACGGCATGGCTTCAGTGTCCAAAAAGGTGGAGCGGTCTGTGGCG
TTACTGAAGAGCTTACTGCAAGAAAGTGAGCGCTGGGAAGCTGGTTCGAACGACTTTGATACGCAGATGAAGACGCTTGTAGGCGACACGTTGCTGTCCT
CTGCCTTCCTCACGTACATCGGTTTCCTTGATTTCCAGCAGCGGAAGATTCTGGTTCAGGACTGGCGTGACATCTTGGACTCGATGGGCATTAGCATGAA
GCCGCAGTTGAGCTTTGTGGACTACCTGTCGCGGCCGAATGAACAGTTGGAGTGGCAGATGAGCGACCTGCCTTCGGACGAGCTGTGCTACGAGAACGCC
ATCATTCTGCAGCGCTTCCACCGCTTCCCGCTGATCGTTGATCCTTCTGGACAAGCGAACAATTTCATCATGAAGTATTACAGCCTCAAGACGAGTACCA
AGATCGCGCAGACGTCGTTCCTCGACAGCTCGTTCATGAAGGTGTTAGCCAGTGCTATTCGCTTCGGCACTGCTCTGTTGGTGCACGAAGTGGAGAACAT
TGACCCGATCCTGAATCCTGTGCTGAACCGTGAACTCTACAAGACCGGCGGTCGCGTGTTGATTCGTCTCGCGGGTGAGGAGATCGACTACTCTCCGGAC
TTCCGACTCTTCTTGATCACGAGAGACCCGTCGTGTCGTTTCTCGCCTGATATTTGCAGTCGTGTGACATTTGTTAACTTCACTGTCACTCCGAGTTCGT
TGGAGAGTCAGGGATTGAGCATTCTTCTCAAGAGCGAACAGCCTGAAGCTGAGGAAAAGCGCAACAATCTTCTCAAGTTACAGGGTGAGTACCAGGCTAA
ATTGCGTGAGCTGGAGGACTCTTTGCTACAGCAGATCAACAATGTACAGGGCAACATTCTAGACGACGACCGGGTTATCAACGCTCTCGAGAGTATGAAG
GCAGAGGCGGCACAGATCTCGCAGCAAGCGGCGGAAACTGAAACCACAATGGCAATTGTGGAGGAAGCGACGAGTCGCTACCGACCGCTTGCGAAGGCGA
GCTCACGCTTGTTCTTCGCGCTGGAGAACTTGTCGTCGGTTCACTTCCTGTACCAGTACTCGCTCGACTTTTTCCTGTCTTTGCTGTCCAAGGTCTTGGC
TCAGTCAAGTCAAGGCGGAGAAGCAGCTCGTCTTGCCAGCATTTCTACCGGACTCTTCGTGCAGCTGGCTAGACGCGTGAGTAGAGGTCTAGCTGAGAAC
GACAAGCTCATGTTCGCGTTGAGACTATCTCAGATTTATCTGGAGCTGGAACAACAGAGTGCTGCAGTCGCTGACGCCAAGACTACGATGGATGACAGCA
GTGCGTTTGATGGACCTACGGATGAAGACATGGACGTGCTTCTTGGAACCTCGTCAACGTTCTTTAATGCTGATAGCGGTGCACAGCGCAGCGAGTTTGA
ACAGCTGCTACCTGCTTTCTCGAAGACTGAGATCGATCAGCTGCTGAAGTTGACGAAGCTGTCGACGTTCAAGCTCCTTGAGACGCATGTGCGTGAGCAT
GCAGCCGAGTGGAACACGTTTGTGAAAACCCCATCAGCTGAGGAAGCTCTCCCAACGGACTGGGATGTGTCAGCCTCTGCAAGCCCGCGTCGTGCGGCGT
TCCGAGACATGATTGTGATTCACTTCTTACGTCCTGATCGTATCACTTTCGCGTCGGAGCGATACATCGAGCTGGTGTTCACGGCAGCATTCCCATGGCG
TGGCGAGATCGAGTTGTCCAAGAATGTCGAGGAAGATACTCAGGCAACGCGTGGAGTGCTTCTGTGCTCTACAACAGGTTTCGATCCGAGTGCGCAGATT
GACGAACTCGCAGCGGTCCAGCAGAAGAAGTACAACTCTGTGTCTATGGGTTCATCTGAAGGCTTCGATGCGGCGGAGAAGGGATTGAACACGGCATTAA
AGCATGGAACCTGGCTGCTGCTACGCAATGTGCACTTGTGTCCGTCGTGGCTCGTTAGTGTGGAGAAGAAGCTTTACAATGCACGCGAGAGTGTGCACCC
GAACTTCCGTCTCTTCCTGACAAGTGAGATCAACCCCAACTTGCCAGTGAACCTCGTGCGCATGTGCGATATCTTCGTGTTCGAGCCACCGAGCGGCATG
AAGCTGAGTATGGTGCGCTCGCTTGACACTGTGGCTGCGGACCGCATGAACCGCTCACCTACCGAACGTGCTCGTCTGTACTTGCTACTTGCCTGGTTCC
ATGCGTTGGTGCATGAGCGACTGCGTTTTGTACCCATTGGCTGGTCCAAGACGTACGAGTTCAGTCAGTCTGACTTCCGTGGTGCTTGCGATGTGATTGA
TCGCTGGGTGGACTCAGTGGCCAGTGGACGTGTACATGTTGCTCCTGATAACATCCCGTGGACAGCTATCCGAACTACGTTGAAGGAGTCAGTCTACGGT
GGTCGTGTGGACAACACGTTCGATCAGGAACTGATGGACACGCTTTTAGAGCATGTATTCACTGCTGCCAGCTACGAGAACACTTTCGAGCTCGTGCCGC
CTGGTGAAGGCAAGGATACTGGACTTGTGATTGCTGAGGGCAAGACGAAGGCGCAGTTTATGGACTGGGTCCATGCTCTGCCGACTACGAACCCACCGTC
GTGGATGGGTCTGCCGCGATCGGCGGAGAGGATGGTGCTCATTAACCAGGGTGCCCGCATACTGCGTAACTTGCAGGTGATGCAGGAATTCTACGGAAGC
GAAGGAGGAGACGATAGCACTGCTGCAGATGACGAGAGTAAGATGGTGCTGGGCACGGCTACTGCTGATGGCGGAGATGCCCGACCTAAGTGGGTACAGG
ATCTGGACCATCGTGTTGGCGCTTGGTTGCAGCTCTTCCCAGCGGAGGGACTTGCTGTGCCCACTGTCCGTGACCCCGTGCACTTCGGCAACCCTGTGTA
CCGCTGTATGTTCCGTGAGCTGGAGCTGGGCGCTAAGTTCCTGAGTGACGTGGTTGGGTTGCTACGCACAGTGCAGCAGGTGTGTGCGTATAAGGCGAAG
CCGTCGAATGAAACGCGCGAGGCCATGCGTACACTGTACCGGGAGCACGTGCCTCAGCAATGGGCACAACTGTACCGTGTCTCGGATGAGCTTAGCTTGA
GCGAGTGGCTCACAGACTTCTCTCGACGTGTGCACCAGCTGAACGCGCTGTCGCAAGTGGATCCGACTGAGATTCTGCAGCAACCTGGTGGTATCTGGCT
CGGTGGGTTCTTCTCGCCTGAAGCGTTCGTGACGGCCGCACGCCAAAGTGCTGCAGCGGATCTTGGCTGTTCGCTGGACGAGCTGCATCTCCTTGCTGAC
GTGGAGGACCCTTCGACTTCGTCTGCCGGTGGCTTTACCGCTCGTGGCCTTCTACTGGAAGGTGCAACTTGGAACTTCACTGGTTTTGCGCCGTCTAATG
AGATTCGCAACAGCTTGTCAGCGTTGCATCTTCGCTGGGCCCCGCAGAGCGAGGAGACGGACAACCTTCGATTGCTTCCGGTGTACTCGAACAGCAAGCG
CGAAACTCTGTTCTTCTCGGTGGCCGTGAATGTCGAGGATGCCGCTTTCCCGAAAACGAAGTGGGTGCAGCGGTCGGTAGCTCTTGTGCTCTGGGAGCTG
CAAGTCTAG