Transcript Name :
Phyin_T30-4PITG_00004
Orientation:
(+)
Number of Exons:
3
Description :
Protein kinase%2C putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain36.824PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain9.5SM00220
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6120.73518
InsideOutsideTMhelix
1-585
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
KO ID
K05743
K05743
K05743
*** None ***
Sequence
        1969 bases(100 bases per row)
ATGCGCGTGTCTGGTCTCCTTTCAATTCTTGCAGCCACTTTGACCACGGCCCAAGACTACACGATCACCTTTCGAAGCCTGGAAGAGCAGGACCCTGAAT
CGTCATCGTTACCTTCAGACTTCTCGTTCGACTTCGATGGTACCAACTCAGACATTGCGCGACAGCTTTACACCCGTCATCGATCTGGCGATACCAGCGC
CGCAGTCTCCATCAAGTCCGTTCCGACTGCAGTGACCGACAGACTCGACTCGTTAAAGATAGCGTTCACTCATTTGCCGGGACTGGTTCAGCTTGCGGTT
CTATGGGATACAGGCTTCGGCATCTCTCCTAATGGTGACCCCGTGCAAATCTGGACCACAGGAGACTTTACCATGGCAGACATCGCCGTATCTCCAGACG
ATATCACTAACGTGAACTGCACGATGTTAGAATGCCCTCAACCAAACGATACGCCAGCTTACTCAAGTCAATATTGTTCTGGAACTCAGATCCTCAACGT
TTCTCGATGCATAGTCGACACGTTCGAGGACTCTGGAGCGAAAGATTTCTTAGGAATAATGTGGTCTACAGGTGGAGACGCGACTATGACTCCCCACATC
CGACTGAGAGATCATACGTGGACGGAGCCCACGACGGGGGTTTCCTACAGTGTCTACGCTGTTCATACGGTTTCTAGCGCCGACGATCCGACGTGGAACC
AATGTCCGGTTAACAATGGCTACTCTTCGTTGATTGTTCCGTGCCACAAGAGAAGCGAGTTCAGTGATGCTGAAATGGCTGCAGTGAACAAGCCCAGAGG
AAGCGAGTGGGTGACGATGTGGCTGAAAGACGAATTCGCTGTCGGGGACTCATCAGGATTCGATGAGCTCTTGTTGATTCCTATTCTTCTCGTGGTGGCT
GCTGCAATGGGGATGGGCTGGTTCTGCTGGAAACGGCATGCGATGCTGAAGAGAGAGCAGTCTTCTTCTTGTTGCGATTTTGACGTGGTTTCTCCAAACT
ACTTGGGTGTAGTAGCACACGAGCAAGCTCGTCGAGGGACGGTGGCGACGACAAGCTACGGGCCGTCCATTTCTAGTCACCAAGGCGACTACGAGAGTGC
AGGCTCCAACCAAACGTTCAAGATCTTGCTGCATAGTCAGCACCTTCTTGGAAATCGAATCCCGTACGAAAGTCTCTCGTTCCAGATGGAATTATCCAAA
GCAGCTTCAGGAGAAGCTTGGATTTGCCAATACGGGAGGCCAACCGGTTGCAGTCAAGAAGCTACTGCACCCTAAAGACCAGAAGGCAGACGACGTGCAA
GCGTTCGCAGAAGAGATTGAGTTGACGGCCAGTCTGATTCATCCTCACATTGTCAAGTTCATTGGCGTGGCTTGGAATAGTCTCAGCAACTTGTCAATGG
TGCTGGAATTTGTGTCGGAAGGAGATCTCCAGGGCTTTTTGCACAAAAACTCCGATGTCTTGTCGTGGGCGGGAGATCGAATCTACATGGCTGTCGCCGT
GGCCGAAGCGCTGGAGTATCTGCACTCTCGAAGCCCCGCAATTATCCATCGGGATCTCAAGTCGAACAATATCCTTTTAACGGAAGATCTCGACCCGAAA
CTCATCGACTTTGGAGTAAGTCGCGGCGTGATGGATCTCACGATGACAGCGGGTGTGGGTACTCCGTACTGGACGGCGCCAGAGGTTCTGGAGGGAGCTC
GATACTCTGAGAAGGCAGATATCTACTCGTTCGGGGTGGTCTTGTCGGAGCTCGACACGGGACGGATCCCGTACTTTGACACAGTGGACCACGATGGAGC
AAAGTTAATGCCCTTCCAAATCCTACAAGAAGTCATGGCTGGCACGTTGCGACCAAGTTTCTCGGTAGATTGCCCGCCCAGAATTCAGCGAATTGCTGCA
GCGTGCCTCTCGTTCGACCCTTCCGACCGACCAACAGCGCAAGAGTTAATCCAGTGGCTTGAAGGTTGA