Transcript Name :
Phyin_T30-4PITG_00525
Orientation:
(-)
Number of Exons:
11
Description :
Protein kinase%2C putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain21.743PS50011
EF-hand domain14.318PS50222
EF-hand domain14.095PS50222
EF-hand domain14.207PS50222
EF-hand domain12.784PS50222
HmmSmart predictionP-Valprediction_id
EF-hand domain0.0012SM00054
EF-hand domain2.9SM00054
EF-hand domain1.3SM00054
EF-hand domain4.7SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-510
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
calcium ion bindingGO:0005509IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2482 bases(100 bases per row)
ATGCGTCTTCTTACGCGCGCGCCGGTACGTTCAAAGGCGACGCCGACGTCGGCAGTGCAGCATCTTCCACCTCCCAAGCCAAAAGAAGCGTCGTACAGCA
ATGGAACGGGTTGGGTGGGCTTTGTGACGACGGCGGCGGCCTTGGGGGTCGCTATCCTGATGCATCGAGATGCGCCAAGCAGCGACGTCGAATGTGGGTC
AAGGAGTGAATCCTGGTGGGCAAGCCCTAAGCTGGAGCAACGAGGACACTATACGCTGCTAAAAGAGCTTGGTCGAGGAGGTTTGGATGCTTTCTGGAAG
AGTTTGCTAAAGGAAAGGCTTTTAATTTCTATTTGAGTGTGAAGGATTTTCCATTGTGCGTCTTGCGTTCGACACAGAGACTAAACAGGTTGGCAACACT
ACATGTAGTAAATGAGCTCGTGTGACGACAGTATCTGATGAGTTTTGCTTATTGATTCGTAGATGCTGGCCGCAAAGATTTTTGATCCGAAAAGCTCGTC
GATGGAGACGATTCAGGCCGAGGTGCAGGTTTATTGTGGATAAATGACATTCTGGGTGCATGCTTTAAATAGTATTTGTTTTTCCTTACTGCAGATTGAT
ATTCTGCGGTATCTTGGCGTGCACCGAAACATTGTGTCGCTGCACGATGTCCTGTATCTGAAGGATGAAACTGTTATGCTGACGGATTTGGTTGAAGGAG
GAGAGCTTTTTGACTACATTGTCGATATGGTGCGGTTGGGTAGTATTGTTTTTCGTGCTTAGAACTGGACAACTCGCTGACTAACATGATCATGTGTTGT
GAAACTAGGGATCTGTTTCAGAGCAAGACGCTGCTCATCTACTGCATGATGTCTGTCAGGCTCTAGACTACGTGCACTCCCGTGGTGTCTGGTAGGCTTT
CACGCTGCATGAATGGCGTCATATTGAGTTGTTACACGGGTTGAAACTGCATTTCGTAGCCACCGCGATCTAAAGCCAGAGAATGTTTTGCTGTCAGATC
GCTCTGCCAAGGCGAACGTCAAACTAGCGGTGAGTGAGTTTCCTTTTGCGGCATCTGTAGGAGAAATCATTGACTTACTCTCGCAACGTTAGGACTTTGG
ATTGAGTCGGCGACAACGACAGGGAGACCAGATAGTGGAATGGGACAGTGTAAGCATGCACTAAAGTTCTGACGGCTTAAGTTGGCGACTTACTTTGTTT
TTGTGTAGCGCGTATTGGGCTCCTGAGATCATAAAACGCCAGCCTCAAGACTTCGGCGTTGACATGTGGGCTTTCGGCGTTCTCGTATGAAAGCTTTACT
CTGGTTTCCACCATCTTGTTGCAGGAAAACTTACCACGTCGCTTTTGATCCTGCTCCAGGCCTATATCACCCTCACAGGAGTGCACCCATATGACCCACG
AGGTGACAAGTCGGACGCGGAAATCGTAAAGGAGATCGCAAATGGAAATTACGACGGTAAAGTCCATTGCCTCTTGGTTTGGATTGGAATTTTACCCTTA
CGTATTGTGTGGCGACTGTTTTTATGCAGTGGAGAACAATTGGTACAAGAATCTGACTGCAGAAGCGAAGGATTTCTTGACGCGATTATTAGATTCCGAC
CCTGCCAAACGGTTAACTGCCAAGCAGGCACTGCAGCATTCATGGCTGAGTGGCATCACGACGTCTGCGGAGCCCCTCGACAGCTGCTACACCCAGCGAC
TACAATCGTATCAGCGCTTGCAGCAACTTCGAGCCAACATTTTGGCAGTCGTCATGGGTGTGCAGCACGCGAAACTGGGTAAAACTTCTGATGCCGATGA
AAAGCGACTCACGTCTCGCCGCACAGCGACCGTGAATATGGACATGTTCAAGGAGACGTTTTCTCTTTTCGACAAAGACGAATCAGGCTGCATCGACCAA
GAGGAGCTGAAGGGCATGCTCTTAGCACTGGGACAGCAGCTTTCAAGGTTTGGCTCTCGCTCTTAATGTTAGTACTGTAACACACCTGTGCTAACTCTCT
GTTGGCTGATTGAAGTTCTGAAATTGATGAGATCATGCACCAAGCAGACACTGACGGTGATGGGAAGATTTCGTTCACTGAGTTTGTTAGTATGATGAAC
GACCGACTATTCCGTCGGTACGAACACGATCTCGGTTTTCGTCGATGTTTGCCACTAATGAAACTGACGTTTATCCATTGTAGCGGGGATCTGACGACTG
GAGATCTCAAAGCAGCTTTCGATGTACGTATTGCAATTATCAGTGGCGATATCCTCACTCACTGCAACGTGGTGTGTTGTGTAGACCTTTGATGTGAATC
ATGACGGATTTATCTCCAGTAGCGAACTCGAGCACATCCTCCATGTGCTTGGCAATAAGCACATCAACAACGAGGAAACCTGCAAAATTATCCAAGCGGC
AGACAAGAACGAGGACGGGAAGATCGACTACGATGAGTTCTGTGCCTTGATGCAGCAGCAACAACAGCACACGAAGAGCTAA