Transcript Name :
Phyin_T30-4PITG_00203
Orientation:
(-)
Number of Exons:
2
Description :
Mitochondrial-processing peptidase subunit beta
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-466
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
2288
Sequence
        1470 bases(100 bases per row)
ATGATGTCCAAGCTGAGCCTCGTGCGCCAGCCGCTTACCCGCGCGCAGTCGTCGGTGGCGGCCGCCGTGTCCAACTACCCGTCGTACGTGCTGAACGCGC
CTGCCACTGAGGTGACGACGCTGCCCAGTGGTCTGCGTGTGGCCTCTGAGGGCTCGCACGGCGAGACGGCCACTGTGGGTGTGTGGATCGGCGCCGGTTC
GCGTTACGAGACGGCTCAGAACAACGGTGCTGCCCACTTCCTGGAGCACATGGCCTTCAAGGGCACGAGCAAGCGCACGCAGCAGCAGCTGGAGCTTGAA
ATTGAGAACATGGGCGGCCACCTCAACGCCTACACGAGCCGTGAGCAGACTGTGTACTACGCCAAGGTTTTCAAGAAGGACGTGCCGCGTGCTATGGACA
TCCTCAGCGACATCCTGCAGAACTCCAAGCTGGATGAAGCCGCCATCGAGCGTGAGCGCGACGTTATCCTGCGTGAGATGGAGGAGGTCAACAAGCAGCA
GGAGGAGGTCATCTTCGACCGCCTGCACGAGACTGCCTTCATGGGCAACGGCCTCGGACGCACCATCCTGGGACCCATTGAGAACGTACGTGGAGTAGAA
AAGCCTGTTGAAGGAGTATAACAGAGTGTCTGACTCCTTTAATGCTTCTATTAGATCCGCAACCTCAAGAAGTCGGACCTACAGGACTACATTGCCACGC
ACTACACCGCTCCGCGCATGGTTATTGCCGGTGCTGGTGCTGTGGACCACTCGCAGCTGGTGGAGCTGGCCCAGAAGTCGTTCGGCGACCTGCCCACGAC
TCCTGCCGTCGCCCCCACGCTCGAGCCTGTGCGTTTCCTCGGCTCCGACGTACGCATCAAGGACGACAGCATGCCGCTAGCTCACGTTGCTATTGCTTTT
GAAGGTTTTAGCTGGACTAGCGAGCACTCGTTCCCCCTGCTGATCATGCAGACGCTGCTCGGCAGCTGGGACCGCACTTCGGGTGCCGGCATGAACATGT
CCTCTAAGCTGGGCCAGGTGGTCGCTGAGAAGGAGCTTGCCCACTCGTACATGTCCTTCAACACGTGCTATCAGGACACTGGTCTCTTCGGTGTGTACGC
TGTCGCTGACAAGTACAAGCTGAACGACCTGACGTGGTACACCATGGAGGCGCTTGTGCGTCTGGTACACAAGACCACCGATGACGAGGTTGAGCGTGCC
AAGACGCAGCTTAAGGCCAACATGCTGATGCAGCTGGACGGTTCGTCGCCTATCTGCGAGGACATCGGTCGCCAGATGCTGACGTACGGCCGCCGTATGA
CCCCTGCTGAGATCTTTGCTCGCATTGACGCCGTGGACGCTGCTGCTGTCCGCAAGACCGCTGACGAAGTCGTTAACGACAAGGAGCACGCCCTGGCAGC
AACGGGTCCTATCCACGAGCTGCCGGACTACAACTTCATCCGTCGTCGCTCGTACTGGCTGCGATACTAA