Transcript Name :
Phyin_T30-4PITG_00003
Orientation:
(+)
Number of Exons:
1
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain13.517PS50011
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-98
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        297 bases(100 bases per row)
ATGACGGCTGGGGTCGGTACGCCCTACTGGATCGCACCGGAGATTCTTGAAGGCAAACGGTACACTGAGCAAGCGGATATTTACTCGTTCGGAGTGGTTT
TATCCGAGCTGGACACGTGCAAGATGCCGTTCTCTGACGTCGTTACGGCAGAGGGAAAGAAACCCAAACCAGTTCAGATCCTGCACTGGGTTCTGGATGG
AAGATTGAGTCCAACTTTCTCCGACAAATGTCCGAGTCGGTTGGAACGCAATGTTTGCAGCATGATCCGAAGCTGCGGCCGACTGCAGCCGAGCTAA