Transcript Name :
Phyin_T30-4PITG_00005
Orientation:
(+)
Number of Exons:
3
Description :
Protein kinase%2C putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain15.863PS50011
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
175-453
1-151
152-174
*** None ***
*** None ***
TypeScore
nuclear348
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        1646 bases(100 bases per row)
ATGGGGAACTACACGATGGCAGACCTGGCAGTACCGAAAGCCGACGTCTCGTACGTGGACTGCACGTACCTCAACTGCTCTCAACCAAATGGCGTGACGG
CGCACTACGCACAGTACTGTACTGGGTGGCAAATGCTCAACGTGTCTCGATGTGTGGCCGACAACTTTGTAGATCCCGGGGGCAGATACTTATCTAGGGA
TGATGTGGTTCACGGGAGGGGACCCCACAATGACCCCGTCCATTCGACTGAGAGATCACAAATGGGAGCAGGATATTCCCGAATTCGGAGGCCTTATTAC
GTTCCATGTGTACGTCGTCCACACAGTGCCACATGACCTTGATCCGGCTTGGAACGAGTGTCCACTGGACGAAGGATACGCGTCACTGACAGTACCTTGC
CACCGAAGAATCGAGTTCACGGACGACTACATGGCTGCAAATACGACCGTTCCAGCTGGATCGGCGTTCGTGACGACGTGGTTGAAACAGGAGTTTGCTC
AGGAGGACTCTCCGTCGCAGCTGTTGATCCCAGTCATCTTGGGTGTAGCCATTGCTGTAGCTGGGATGGCTCTGGGGTGGCTCAGCTGTAGACGAAAGTT
AGAGGCCTCAATGAAGCAAAAATCAGGAATCGAACACGAAAGACGCTCGCAACGTTCAAGTGGGAGCTCCCAGGAGAGACGAGCCATTTCTATCTCCAGT
CCACAGCAACGTCGAGATTCAGCAATCCAGAGTCTTTACTGCGAGAGAGCGGGGTCGAACAAAACTCTACTGGATAGTGAACACCTCGAGGGCAAACGCA
TACCCTTCGACTCGATCGTGTTTGAGAGGGTTATTTCTAAGGGGGCGTCGGGGGAAGTGTGGGTTTGTGAGTTCAATCGACAGAAAGCGGCGGTGAAGCG
TCTACTGCAGAGGAAGAAACAGAAAGCGGAAAGTGTTCAGAAATTTGCCTTGGAGATCGAACTCACTGCCAGCCTCATTCATCCGAATATCGTCCAGTTT
ATCGGTGTGGCCTGGAATAGTCTTGACAATTTGGTGATGGTGTTGGAGTATTTATCAACGGGAAGTCTAAAGGAGTTTCTTGAAGAACCGAGAGAATTTA
TGGTGGACTAGAGATAAAATCTACATTGCCATTGGAATCGCTCGTGCCTTGCAGTATCTGCACGCCCGTACGCCGGCTCTGATTCACAGAGATATCAAGT
CCAGCAACGTTTTACTCACAGATTCAATCGAGCCAAAGATCATCGACTTTGGCGTAAGTCGTGGTCTTGTCGATCTCTCAATGACTGCAGGTGTAGGCAC
GCCGTTCTGGACAGCACCTGAAATCTTGGAAGGTAACCATTACACGGAGAAGGCGGACATGTACTCGTTCGGTGTCGTGTTGTCCGAGCTTGACACTGGA
CAGGTTCCCTACCACGATGCCGTGACGGAAGATGGAACCAAACTGAAGCCGGTCCAGATACTAAAGGAAGTCATGTCGGGCACGATGCGACCAAGTTTCT
CCGACGAATGTCCACCTAGAATTCGAAGAATAGGAACCGCCTGTCTATCTCTTGACCCTTCCAGTCGTCCGACAGCACACGAACTCGTTCGGCAACTCGA
AGGCAGGGATAGCGAAGAAGAAGAAGAGGGGGCTAGAACACTTTAA