Transcript Name :
Pytul_DAOMBR144PYU1_G014178
Orientation:
(+)
Number of Exons:
1
Description :
Similar to has1: ATP-dependent RNA helicase has1 (Schizosaccharomyces pombe)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-608
*** None ***
PositionContextScore
451RVGRTAR|GA0.568
584SRKRFQR|SG0.545
*** None ***
GO
*** None ***
*** None ***
Cluster Id
2912
Sequence
        1827 bases(100 bases per row)
ATGGCAGGCAAGGCGCGTAAGAAAAGCAAGACCGGAGCGGCGACGCCGGTGGCAGTGGCCCCTGCGGTCCCGGTAAAGGCGAGCACCAATGGCGCAGAGT
CGAATGCCAAGGCGAGCAAAAAGCTCGTCGAGAAGGTTCCAGAGCCAGAGTCATCGGACGACGAAGAGTTAGAGTTTGAAGATGACGACGAGCAGGACGA
GGAAGATAAGCCAACAAGTGCAAAGGAGCGCGAACAGGAAGAAGAGGAAGAGGAAGAAACCGAGCAGGCACTTGCGGAAGTAGCCAACCACGCTGCGCAA
GAAGGGGGCGTTGATGAGCGATACTTTTCGAACGAAGAGTTCGCCTCTTTGCCTCTCTCCGAACCAACGAGAAAGGCGCTGGACGAGATGGGCTTTAAGA
AAATGACCAAAATCCAGTCAAAATCGATCCGACCATTGCTCGCGGGACAGGATCTTCTCGGTGCTGCAAAGACTGGTTCGGGAAAAACCCTGTCGTTCTT
GATTCCCGCCATCGAGCTTCTCCACAAGGTGAAGTTCACGCCTCGTAAAGGAACTGGATGCATTGTGATTTCGCCAACTCGTGAACTGGCGTTGCAGATT
TACGGTGTTGTGCGCGAAATCTGCAAGTATCACTCGCAGACCCATGGCATTGTCATGGGTGGTGCGAATAGACGTGCGGAAGCGGAGCGTCTTGTGAAAG
GTGTGAACATTTTGATTTCGACTCCAGGTCGTCTTTTGGATCACTTGCAGAACACGAAGGCGTTCATTTACCACAACCTGCAGATTCTCGTCATTGATGA
AGCCGATCGTATCCTGTCTATCGGTTTTGAAGATGAAATGCGTCAGATCATCAAATGCATTCCGAAGGAGCGCCAAACGATGTTGTTTAGTGCCACACAG
ACGAAGAAGGTTGAAGATTTGGCGCGCTTGTCCATCAAGGAGAAGCCCGTGTACGTTGGTGTCGAAGAAGAAGACACGAAGGCCACAGTGGCCACGTTGG
AACAAGGTTACGTGGTTACTCCAAGTGACAAGCGTTTCTTGCTTCTTTTTACGTTTTTGAAGAAAAACTTGAAGAAGAAAGTCATGGTTTTTTTTTCGTC
CTGCGCCGCGGTCAAGTTTTATGGAGAGCTTCTCAACTACATTGACATTCCGGTGATGGACATCCACGGCAAACAGAAGCAAAACAAGCGTACGACGACG
TTCTTCCAGTTCTGTAACGCAAAAACCGGTATCATGCTGTGTACGGATGTTGCCGCTCGTGGTCTCGATATTCCTGCTGTAGACTGGATCATCCAGTTTG
ATCCGCCAGATGATCCAAAGGAATATATCCATCGTGTCGGTCGTACTGCTCGTGGTGCTAAGGGCAAAGGTAAAGCCCTTTTGATGCTGTTGCCTGAGGA
GTTGGGTTTCCTGAAGTATCTGAAGGCTGCCAAGGTCGCCTTGAACGAATATGAATTCCCATTGAACAAGATCGCAAACGTCGAATCCCAACTGATGAAG
CTCGTGGAAAAGACGTACTATCTGCACAAGTCCGCCAAAGACGCGTACCGTGGCTACTTGCTTGCATACGCTTCCCACGCTCTCAAAAATATTTTCGATG
TGGGCAGCTTAGACTTGCAGGCCGTCGCGAAATCGTTTGGTCTTGTTGTTCCGCCGAAGGTGACGCTTCCAGTCAAGACGAGTGGAAAGACGGGCAAGCG
AAAAGCTGGGGGATTTGACGACGAAGGTAACTCGAGAAAGCGGTTCCAACGTTCGGGTCACGCCTTCAGCTCGGACAATCCTTACGGGAAGCGCGCGGCA
AACGACAAGCGTCAGTTTGCTCATTAA