Transcript Name :
Albla_Nc14000330
Orientation:
(+)
Number of Exons:
10
Description :
phosphatidate cytidylyltransferase putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00981
K00981
Cluster Id
3607
Sequence
        1602 bases(100 bases per row)
ATGGGTGCGCTCATGATTGCATTGTTTTCGGCAATACTGTATGGTGGACATCTTTACGCTTGGATACTGGTTGTCGTTCTACAGACGCTTATATTCAAAG
AGTTAGTGAATGTTCGCTACAGAGCAGCAGCGGAAAAAAATATTCCGTGGTTTCGATCCATTCAGGCAAGTCATGAATTATAGAACGGAATTGATGACCC
AATGAAATTGTAGTGGTCGTGGTTCTTAGTCGCTCTCATTTACAATTATGGAGATTCGTTTGCAACTTTTGTTGAGACTCGCAAGATCCGAGTGGTTCCA
CCGTTTGTTGTCCGCTATCTTGGTTATCATACGTGGGTATCATTCAGTTTATATGCTGTTCTATTTGTCATGTCAGTTCTCAGTCTCAAGAAAGGCAAGT
CTTTTGGTTACCATTGTGTTTCAACTAATGCTTACCCATCGCTCATTAGGATATTACAAATATCAAATGGGTGAGCACTTTTACATGGATCAGTATCAGC
AAGTTTTTATGTACTTATACTTGCAGGCCAGTACACATGGACTATAGTCACATTAGGGCTTATCGTGTTTCAGATGAAATACGTCTTGTTCAATATTTTC
AATGGTTTGGTCTCAACACTATCTCTCACTTACAATTTTTCATTCCTTCCGTGTTTTCAGGCTTGTTTTGGTTTGTTTTCCCAGTTTCGTTGGTCATCTG
TAATGATTGTTGCGCGTTTTTCTGTGGGAAAGTTTTCGGCCGAAAATTCATCCGAACTCCCTTTTTGCGCTTATCACCTAACAAAACGTGGGAGGGATTT
GTTGGAGCATTTTTGTGTACAATTGTCTTTGGAGCACTCACGAGTGCAGTATTTGCAAAGGTATACAATATTTACACCGTCCAACTCAACAAGCGCTCAA
GCGTTCACTTATTGTATCTAGTTTCAATGGATGATCTGCCCTCTAGAAACTCTACAGGTAAGCTCCCTTAGCCCATTTTTTAGATATTGAAAAGTCAAAC
TTGTTTTTGTAGCTGATCCCAGCTGATTTGTCATGCCACCCCAATCCGGTCTTTATAGCAGCAGATTATCACTTGCCATCGCATGTCGCATATTATTTAG
GTAAGAAGACCATAAAGCTCATGCCGATCCAGGTAATGTAGCTTCACAAATGCATAAGTTGGAAAGGTTTGTAATCTGGCCTTGGTTCCATAGCTGCATT
CCATGGTATTTTCGATCTTCACATCCCTCATCGCACCATTCGGTGGCTTCTATGCGTCTGCCATCAAACGAACATACAAACTCAAGGTGCGTCAGTCTCA
CTTTCTTGAAGAACGTGCAATATTACGAATGTGATTTGGTAGGATTTTGACTCTGTGATACCGGGGCATGGTGGTGTAATGGACCGCATGGATTGCCAAT
TCATCACAGCGCTATTCACGACTGTTTACTACAACACGTTTATACGGTACATTGCTCCTTGGATTCATGCTGTTCATACGAGCTCAATTTGAATCTGTAT
AGATCTCAAGAACCGTCAATAGCTCTGATCTTGAATATGATATCAAGGCTTCCACTAGAAAAGCAGCAAATCGTGCAGCAGAAATTGCAGGAAATGTTTT
GA