Transcript Name :
Pytul_DAOMBR144PYU1_G007648
Orientation:
(+)
Number of Exons:
1
Description :
Similar to nek3: Probable serine/threonine-protein kinase nek3 (Dictyostelium discoideum)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-903
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
1865
Sequence
        2712 bases(100 bases per row)
ATGGATCCGTCGGAAGTGTCGGTGCTGGTCGTGGAAGATGACGAGTTCACGCGCATGGCGACGATCGACATCCTGCGCAGCTGTCGGTACCAGGTCGTGG
CGGTCGAGAATGGCAAGCTGGCGCTCGACCTGCTGCTGAACAACCACGGCAAGTTCGACCTCGTGCTGTGCGACATGATGCTCCCGGTGATGAACGGCCT
CGAGCTGCTTGAGGAGCTGCAGAAGCACAGCACCACGCTGGGCCACATCCCCGTCGTCATGGCGTCCAGTAATGAAGGCATGGACGTCGTCACGTCCTGC
TTGAGCAAGGGCGCCAAGGACTATCTGATCAAGCCGATCCAGGTGAACACGGCCAAGACGCTCGTGCGCCATGTGTGGCTGAGCCGCCGACTGGAGCACA
CGACGACCAAGTCGATGTGGCAGGACATTGAAGTGCTGCGCACCATCGGCAAGGGAACGCATGGCACAGTCGTGCTGGCACGACGAAAAGTGGACGGCGC
TGTCGTTGCCGTGAAGCGCGTGCGTACGGCGCAGATCACTGAAAACGGACGCAAGCAAGCAGACAACGAGGTGATCCTGCTCAAGTCGCTGTACCACGTG
AACATTGTGCGCTTTTACGACCATTTTCTCGTCGACGATGAGCTCAATATCGTCATGGAGTACTCGGATGGCGGCAACTTGCGTCAGCTTGTGAAGATGC
GCTCACGCGAGAAGATGGGGCCGTTCCCGGAAGGTGTGATCATGAGCTGGTTTGCGCAACTCGTGCTCGCTGTCGCGTATATCCATGGGAAGAACGTGCT
TCACCGTGACCTGAAGGCGCAAAACGTGTTCCTTACGCGTAAGAATGTAGTGAAACTGGGCGATTTTGGTATTTCGAAAGCGCTTGCTGGTGACGATACG
GCGAATACCGCGTGTGGTACTCCAGAGAGTATGTCGCCAGAGATTTGCCGCGGTGAGCCCTACGGGAAGAAGTCGGATATCTGGTCACTTGGTTGCATTT
TGTACGAGATGATCATGCTCAAGCGGCCATTCGAGGCGTCGACGCTGCCTGAGATCTTCACGAAGATCTGCAAGGGTGATTATCCGCCAATTCTGCCTTC
TTTCTCGCGCGAATTGCGATTGCTCGTTCAGCTCATGCTGCAGCAGGACTCGTCCAAGCGTCCTTCGATCGAAGACATTTGCCGATTCCCATTTGTGCAA
GCTCCCATCCAAGCGTTCCTTTCGCAGCACGTGTCGGAGTTCCAAGAAGCGCTGGAGCTGGAGGCGAAGCTCCACCAGCCATCGCTGTACAGCATGGGTG
TTCGCAATACGCCGATTTCGCCTGTGTCCCCATCGATACGCCGTCGTAACCCGAATGAGGCTCCGTTCACGTCTAGCGAACAGTCGAACAACAGCGATGT
GGAGAAAGCGTCACCAGTGTCATCTCGCAGTGATACCTCGAGCAATGCTGGTATGAACTACGGTCCACCGACGACGCAAGAGAAGGGCAAGATTCGTACT
TCTGCGATCGCTGCTGCGGCTGTTGGACTGGCGATTGATTCGGCGCCTGCGCTGCACCACCAGAGTAGTCTCGACTTTGTGCAGATCAACGGTGATATTC
CGGAAAGTCTTGAAGATTCACTGGCAGATGAGCTTCGATCTAAGGTCGAGATCGCGGATGTGCGTGTTGGTATGTTTACAACCTACACCGCGTGCATTTC
GGGTCGCAACTTGGCGCAGGCACTGAAGAAGCACTTTGCCGAGGCAGAGAATGAAGCGCACATGATTCTGAACGAGTTGCTGAAGAAGAAGGTGCTTAAC
CTGGTGTTTGCTGAGGACATGTCTCGGCCAGATGTGTCTCGTGCCGACACGTATCTCCGGTTTCAAGTCGATGAGATGTTCGGTCCTCTGAATGCGAAGT
ATATCTGCAACGATACGATTGCACCGGGGGCGATGGAGATTTGCCTTCGCGTTCGCGAACTGGTAGCGGAGTTGCACACGGCAGAGTCGTTCCCTCGTGG
CATCTCTTCTGGGTTCAAGAAACCAAATCCGTTTCCAGTCACCCAAGAAATCGAAGACTATGATTCTCCGTTGTGCTGTAAGTACCGTCGGTTCTTAAAG
TTGGTGTCGAAGTTGCAGAAAATCGATGTGGGTTCGGTGCCTAAGCACGAGCGTCAAGCCTTCTTCATCAATATTTATAACACAATGGTGTTGCACGGCT
TGATCGAGTTTGGCGTGCCGCAGAACTCTGGCCAGTACAAGGCTTTCGAGAAAGATGTGAACTACTTGATCGGCGGAATGGAGTTTACTCTGGGAGATAT
CAAGCACGGCATCCTGCGTTGCAACCGAAAACCGCCAGCCAACTACTGGGAGCGTCAACTGCAGGCTCAGGACCCAAAGTTGCAGTTCCGTCTTCACATC
CGTGACCCTCGATCGCTGCTGGTGCTGATCGATTGCTCAGAGGCCATTCCAACGGCGGAACAAGTGCCAGTGCTGAAGCCAGGGCGAACAGATACCGATC
TGGAAGAGCAAGTGGAGAAGTTTTGCGCTCGCCATATCGAGATCAACGACCGCACAAGCGAGATCCTGCTGCCTCGAGTGTTCCGCATTTTCCGTGACGA
TTTTGGCTCCTCGGAAGCAGAAATGGTGTCGTGGTTGTCGCAGTACATGGAGAACGCGCCGACGCATCTGCTCAACTACCGCGTTCGTTACATGAGTGGA
ATCTCGTCTTGA