Transcript Name :
Phyke_g4242
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_508492
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain21.863PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
InsideOutsideTMhelix
1-64
120-150
201-254
312-331
376-387
440-495
88-96
174-177
278-291
350-352
411-419
65-87
97-119
151-173
178-200
255-277
292-311
332-349
353-375
388-410
420-439
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1708 bases(100 bases per row)
ATGTCGGACAAGACAGCGTGGAGGAAAGCTCCTATCGCTGGAGGCGACATCTCTAGAACGTTGCCGACAGGCAAACGCCGTTATGTGACTGCGCTCCTGT
GTCTCTGGGTCTCCACCATCTGCTACGCCGACCGTAAGTGACATTGATCCCCTTAATCTCTTTGATCAGATTTGTTCTTAATGAAATCTCGTGGCGTCTG
TTTGGATACTTTAGGGACCAATATGGGCATCGCATTGCCAGCGTTCGTGACCAACAAGACACAGCAGGGAGAAATTCTTTCCGCTTTCTTCTATGGCTAC
ATGTGCACTCAAGTATGAGTCAATCTCCTTCCCCTCCCAGGATCTCAGCTTCCTTACAACTCTTGCCTGTTTGTGAACATTGCTATAGATTCTGGGAGCC
TATTTTGCTGCCAGATTTGGAGCCAAGATTGTGTTGTTGACTGGAGTTGTTGTCTGGACACTGTTCGTACGTGATGTTATGAAGACTAGTTGGAGGTTCT
TTGCTGACTGTGATTCTCTATTTTGTCAGGACTTGTCGACGGTTATTGTGGCAAAATGCCTCACCTGTTTGTTCTTCGCTCGTGCCGGTATGGGCCTTGG
GGAGGGGATTTTGTTCCCGTGCATGCATCAAATTGCTGGGGCTTGGTACCCGTTGCAAGAGCGCAGTCGCCTTGTGTCGCTCGTGGCAAGCGGGTCGGAT
CTGGGCACAATCACGGCGTTGCTGGTTTCGCCTGTTATCATGGAGACGAGTGGATGGCAGCGTATTTTCGTTGTGTTTGGTGTGCTCAGCTTCATTTGGG
TCGTGGTGTATTTTTTCATGGGGGTGAGTCGACCGGAAGAGGATCCCCACATCTCAGTGGAGGAACGCAGTTTCATCGTGCGTAACCGCACCATTGACCC
AGACACCCATCGCCGCCAGAGCTCTCGCGCTGAGTTGGACACGCATGCCATGAACTGGCGCGTGCTGCTGACTTCTCGACCGGCATGGGCCATCTACGTA
GCGCATATGTGTTACAACTACAGCTGGTACATCCTGTTGGGATGGATCCCGCAGTATTTTGAGCAAGTGTTGGATATCAACTTAGGCAAGAAGGGTgggt
ttgctgctgcgttacCTTACATGTGCGGGTACACTGGCACGCTGCTGTTTGGACGGATCGGAGACCTCCTTGTCACGCGTGGATATCGTGAGCTGCATGT
GCGTCAGGGCATGAATGCGTTTTCTTTCTTAGGGTgcgctttcttcctcttctcgcTGCGCTTGGCGAAGACCGCTCCCGTGGCGGTGGGCTTGCTGTCT
CTGACACTGTTCACTAGCCGTGCAGCCATGGCAGGGTATTGGGTCAATATGATCGACGTGGCACCCAACCACGCCGCGCACGTGATGGGAGTCTCCAATA
CATTTGGAACCATCCCGGGCATCGTTGGTAACATCGTCACTGGCACAATTCTCGAAGTCACCGGGTCGTGGGACCTTGTGTTTGGTATCGCTGCACTAGT
CCTTGTATTCGGCGCAGTTGTCTTCCACTGCTTCGCCTCGGACAAGTCCATCTACGCTGCTGACGCCGACAGCTCAGAAGGATACAGCagtaccagcacc
acgttAAGCAGTTTCCCTGGAACCCCTAACTTCGGCCTGAATGTATCGTCAACCTCAAATTCGGAGCttcatgacgaagaagagagtcTACTTGAGAACC
AAATGTGA