Transcript Name :
Phyke_g5190
Orientation:
(+)
Number of Exons:
5
Description :
mitogen-activated protein kinase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
NUDIX hydrolase domain11.911PS51462
Pleckstrin homology domain8.398PS50003
Protein kinase domain45.658PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4.6SM00220
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
InsideOutsideTMhelix
1-1386
NN-scoreoddsWeighted Score
0.5321.4290.003
*** None ***
TypeScore
mitochondrial348
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
hydrolase activityGO:0016787IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        4636 bases(100 bases per row)
ATGACCACTAAGGCGCGGAAGTTCGTGGAGCAGAGCGTGGTGACGTCTCTGGTGCCGCTACTCAAGCGCAACTTGGCCAAGCAGCCTCCCCCGCGCCATG
ACGCACCTTTTGTCGTACGTAATATTCTTTCCTTCACTAAAATGCTACTTTTCTTAATATTGACAAAATACGTATCAATTATTATATTAGCGTGcaagtg
ttgctgcagtgttccgatggaaggagaaggagcagcacacTCTGGAGATGCTCTTTGTGCGTCGCACTGTGAACGAGAAGGATACGTGGAGTGGCCAGGT
AGCATTCCCCGGGGGTCGTCGtcagaagaagaccaagatggACCTCAACATGGACAATATGACCGAGGAATGGAGTGATTGGGAGTCTCTCCGGGAGACA
GCGCAACGCGAGACAATGGAGGAGGTCGGACTGGACCTCACAACGTCGTACGTGCACGCTCGCTCATTGAGAATTGGTCTTTAAGATCTGAATTGACAGA
ATCTGTGTGCATTTTGAAGGCACGTCCACTGGATCGGCAACTTGTCTCCAATTCAGACGCACTTGCGCTCACTGAGTGTCAGCACGCAAGGTATTGATGG
TGCTACTGCGCGGTTTTAACCGTAGAGATTTCTGTACTGACGAGTAACTTGCTGTGCTGGTACTACAGTGTTCTTCAttgacactgctgcagaggacCAT
GACTACCAGCCCAAGTTACAAGCTTCAGAGATCTCGGATGTGTTTTGGGTGGATGTTCAGGAGTTCTTCAACACGCGACGATACCAGGAGCTAGCGTATT
CGCTGCAGGAGAGTATGACACATCTGAAGAAAAGCCCGCGTGTTCTGGCGGTGGCACAGAAGATTTTGGGCAACATGTCCTTCGACAGCATCTATCTACC
ACGTCCAGGCCACCCTCTACCTGATGATGAACGACTCCCGCGTCGTGACGCCAAGGACTTTGTGCTGTGGGGACTCACGCTTCGTGCTGTGGTGAACCTC
TTCATTGTGGCTGGTACACCACTCCCCATGCGTCCTGAGGCTCAACACTTCGACTCAAAGCTGCTTGGGGCTTTTGTGCTGTACTGTTTGCGTTATCCAG
ACAAAGTGGTTGCAGGTACTGCTACCATCTCAGCAATGCTCCTTGTCAGTGTGCTCTACAGCCACCTCTAAATGAGCCCTACAACTTGacgacatggcta
cattgtCTAAAACAGGGTGTTAACTTTTTATAATACCGCTCCATTTAGTCTCTTTTTGAAACTGATTTACCTCGGCAGAGACGGTGATAAGGCTCTTTAG
TCTCTGCGTATGGAGACTTCCGGCGTGTCTCCGGGCTTAGACGATGGCTTATCTTCTTCCCCAGACGAATATGCTTCTCCTCAATCCCCTCCGGTGCCGA
TCGCACTTCATCCGGCGTCACAACAGTCTCAAGAACGTCGTCGTAAACGTGCATCCAGAGGTACATCTCTCATCGACGCTGTTGGGAACAAACTATTAAT
GCAATTAATCCCCATCCGATGGGACGGACCTGCCCGGAAGAAAGGCGAGTGGCTGCCACGTTGGGACGACGTTTACTTGAGTCTGGACGGCGTCACACTG
CGCGTCTTCGAGTCTCGAAATCGTTTCCTGGAGtttcaagagcaacagcagcaattaCAACAGGAATGCAACAATTTaaagcagaagcagcagcaatcta
CAGCTTCCAATGCTGTTATAGACAGGAAACATTGCTATACAGTCACAGCTGTGGACAAGGAGAGTGTGGGTCGTCCCCATGGCTTTCAAGTCAAGACAAA
GGAGAAGAGCAAACTGCTGCATATAGCAGCGAACAGTGAGCTGGAGAGAGTACTGTGGCTGCATTTATTAGGTGCAGTAGTGGAACAGGTGGAGGATGTA
CTGCCCAAGGTACAGAAGAGACTAGAAGCTTCAGGTTCCAAGGCCAGGGTGGACCCGAGGTCGGTCACTCTCGCCCCTTTGTCAACACCTAGAAGACCTA
GAGCACAGACGTTGACACTGCTGGGAACGCCGGTGAATGTGGAGTTGAATGTGTTCTACGATGCGTGGGGGTGTATACAAGCACGAAAAGGAAACTTTGC
GCTGCTCATGCCTAGTCTGCATCCAAACATCACACTGACGTCGAACTACCCGCCAACCGTCCCAGTTGCGGGAGAATATCACGGGTTGCCTGGTGTACTC
GCCTTCTTTTCGAATCTGCATGGATCGATGGATGTTGCGCATTACGGCGTGGAGCATGTGGCACGTCGAGGAGACTTGGCGGTCGTGTCTGGTCGTGAGA
CGATTCGTAGTGCGCAGAGTGGGAGGCGCTTTCGCCATTTGTGGAAACATGAGCTACGATTCGAAGCTGACGGACGCATTAGTCATATCAATATTTTGGC
AGacaaaactgcagcagcagtagcatttGCCAGTGGAGGTGGCAGTGGAGTGGGTGCGGTGAATGGTGAGTCAAACGGACCAACACTGGCCGCACTACCG
CGAGAGCGCGAACCACAGGCTAGTACGTGTCCACCTGGCGAAATCCGTGTGGTGTGTATTTCTGGTGAAAATttacgacgacgaaagcccgtcgcagcaa
ctgcaccgggaggaggtggaggctTCAAGGTGATATTTGGGCTAAATGAATTTCCACACCTCACCGCCAAGACAGCTAGTAGCAATAGTAGTAATAACAG
GGATGTGATGACTACCACGGCGGATGGGATGAGTCGCATTGGCTCGTGGAAATCGTATTCGACTCGCGTGGTGAAGAGTAGTGGCGGTAAGAGACCGTTT
TGGGCGGAGACGCTGCACCTTGAGTTTTCCGGGGCTGTGCCTGGCTCGACAGCGAGTTTATGCATCGATGTGTGGAGCCTTGGTGTCATCGGTGACGAGC
TTATAGGCTGTGCCAAAGTGAATCTCGCAGACTATTTAGGTTCATCGGAAGGTACCGAAGAACAGATCGCATCGGCTGCTGTCCCAAAATGGTATGATCT
CTACCGAGCCGATTCATTCCAGAAGGGTGCTGGAggcgagagcgagagctgTGGACGCCTGGAGCTTAGCATCAGCTTTGCGCCGTATACAGAGAAGGAA
ACTTCATCGAACGAAGATGATAACGGGGGTGGCGAGAGTGAAGAGGGTGAACAATCACGTGTTTCTGCTGACGGAATAACTCCGAGCGGTCGAACACCTA
AGCACCGCATGAGTTTTGACAgactgcaggagctgcacaaggAAACTGGCCAAACTCAGCGACTTGTCGAGCGTCGGTCATTTGCTGGAATGGGTGGTTT
TGAGATGGTGGACGTTGCAGATGCCACTAACAAACAGGAGGGGAAAATATCGCCGGAGGACAAAGATATGTACACATTTACTGTTGCCTCGACCAAGTTC
CGTGTTTATAGGCGATATCAATTGATTCGTGCTATCGGGCACGGAGCGTACGGGGTTGTCATCGCAGCGAGTGACCAAATCACGGGCAACTCGGTGGCAA
TCAAGAACATACCCCGTACATTCGACGACCTTGTGGATGCCAAGCGCATTGTACGCGAGATCCGACTCATGCGTCACATGCAACATCCGCACGTCGTAAC
GGTGCTAGATGTGATGCGTCCGCCATCGCTCGATCATTTTGAGGACACGTACATCGTCACAGACCTCATGGAAACCGACCTACACCGAGTCATTAACTCG
CCTGAGCCTTTATCAAGCGATCACATCGCTTTTATCACGTACCAGCTTCTATGTGGGTTGCGCTACGTGCACTCAGCGCACATTATCCATCGCGATGTCA
AGCCATCAAACGTGCTAATCAACCGCGACTGCTTGGTAAAGCTATGCGACTTTGGATTAGCACGTGGAATTGATATCCGGCCTGTCACACCTTGCAGCAC
GGATGGAGCCAGTACACCAAGCAGCCAAGACGGTGAGCCTGCACTAGATGAAGCCTTGACGGAATACGTCGTGACTCGTTGGTACCGAGCTCCAGAGCTG
TTGCTTGCGAGTCGTTACTCCACAGCCATTGACCTGTGGGCGGTCGGATGCATTCTTGCGGAGATGTTTACACGCAAGGCACTCTTCCCGGGCCACGACC
ACGTGCACCAGTTGCATTTGATTCTCCAGCTTGTCGGCAGTCCGTCGTCTGAGGACATGGGCTTTGTCACCAATATGAAGGCTAAGCGGTGGATGGCCCG
ACAAACACAGCATGAAGCCAAACCGCTCAGCAGTGTCTGTCCAAATGCACCGTCAGAGGCGTTGGATCTATTGACgcagttgttgcagttcGACCCGCGC
AAACGCATCTCAGTGGACGATGCTATCGCCCACCCGTTCCTAGCGCCATGCCACGTTGACGGCGCTGAAGTGGGTTCTGAAGATCTGGCGCAAAGCGCTT
TCGACTTCTCCTTTGAGCGGGAGAACAGGGGCAGTATGGACAAGAATACACTGAGGCGTCTCATCTTTGAGGATATCTGTTACTTCCACCCGGAGGCTAC
CACCGAGTTAGAGCAGTTCacacaggagcaggagcatTTACGGCGCATGGAAGACGAGAAACGaaagaaggaggaagaagctctggCCCTGGCGGCTGCA
AGCCAAGCAGGGAAAAGCTGGGCCGTCAGCGTTTAG