Transcript Name :
Pytul_DAOMBR144PYU1_G002042
Orientation:
(+)
Number of Exons:
2
Description :
Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-278
NN-scoreoddsWeighted Score
0.7724.2080.008
PositionContextScore
56MSARQLR|DP0.558
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        851 bases(100 bases per row)
ATGCACCACGAGATTGTTGAATCTCGAAAGCAGGTCGCAACCCCTGTTTCGTCCTTCAAGACGGTGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGGCG
GAGAGAACGAGCCTCTTTCGAGATGGTTCGTTGAGTTGGATGCAGCAATGTCTGCAAGACAACTCCGCGACCCCTCGCAGCAAGTGTTGTTCGCAATGTC
CAACCTTGCGGGTCGTGCGAAGAGCTGGGCTTATGGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATG
GCGTTTGAACCACCGCAGAGTGAGTTCCGTGCACGCGCCGAGTTTCTCAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTT
ATCTGGTCTCGAGCATGTGGACGAGCCGATTGACGTCCCAACGCAAGTGTGACGTCATGACGGGTCTGAACGACGGTCCATCCGGAACCAATTGTTCCGT
GAGTACCCAAAGACCCTTGAAGAAGCCATCAGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAA
GGCAATCGAACGTCGTTCATGATGGTCCAGAGCCAATCGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCG
TTGTGGGAAGTCGGGTCACTTCGCTCGAAACTGCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCACGCTCGAACAACTACGGCCGTAGTAAT
GGTCGTCGGTTCGATCGTTCCCAAAGGTCAAAAAACGGGAACGACCAGTAG