Transcript Name :
Pytul_DAOMBR144PYU1_G001075
Orientation:
(+)
Number of Exons:
4
Description :
Similar to truA: tRNA pseudouridine synthase A (Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E))
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-367
*** None ***
PositionContextScore
159IRSRYKK|YI0.687
233AKVRVRR|HV0.692
*** None ***
GO
*** None ***
*** None ***
Cluster Id
3934
Sequence
        1326 bases(100 bases per row)
ATGACGCTGGAAATGGCGGAGCAGGAGCACGCACGTCGGCAGCGCAACGACACTGCAGGCGACAGCGGAGATGAAGACGAAGACGGAGAAGCTGATGACA
ACGTGGAGCAGGCGACGCGTCGCTGGCGCTACTGCCTCCACATCGCGTACCTGGGCACAGGCTTTGTGGGCTGGCAGCGCCAGAACGAGAAGAGCTCTTT
CGGCATGGGCAGCGTGCAGGAGCTCGTGGAGGACGCGATCACGGAGATCCTGCAGGCGAAGGAGAGAGTCAACGTCACGAGCGTCAGTCGCACAGATGCA
GGCACGCACGCACTATACGTGAGTAGCATGTGCTGTTGGGTGTTGGCTGACTGTGAAAATGACGCGACACCATTATTTTCGTGCATGTAGCAATACGGAA
CCATTCGATTGGCGTTGGAGCTGCCCATGTCATTGGAAGAGTTCAAGGACCGCGTCAACGCCAAGTAGGAGCTGCGGTTTATTTACATTCTTGAGTTTAT
CTGCAGCTGAGAAGACTGCTGTGATGCTTTTGACGCTAGGTTGACGGACAATGTGGTCGTGCACCAAGTCTCGGAACTGAATGCGGTCACAAAGCCGACG
CGCATTCGGTCACGCTACAAGAAGTACATTTACTACATCCAGCAAGGCCATCGTCCAGACCTTGAACTGGGCAAGTACTCGTGGTTTATCGGCAAGAAAG
TTGACCCGCAGCGTCTTCGCGATGCCCTCAGGTACGTCTGCTTATTGCAGGTGACCAATTGCTGCCATCAATATGCAATCTCATTCGTTTTGTATGCCTT
GGATAGCTACCTGGTTGGTGATCACGACTTTCGTCCATTCTCACAGGGACTCCAGAAGGCCGAATTTGCAGACAAGACCACGATTCGAACGCTCATTTCG
GCGAAAGTACGGGTACGAAGACACGTGAATTTCTCGCTCGACCCGGCGTTGTGTGGCATGGGAGAGCTCATGGATGAAACCGAGCACCTCACGCTCCCGG
ACGCGTTCACCAAGTTGCCTCCGAGCACCAATGCTGCTGTTGCTGAGGCGAACGAGAAGAAGAAACGCAGGGTGGAGAGACCGTCTACCCCTGTGCATTT
CATCTGCGTTGAGCTGATTGCAAACGGGTTCTTGAGACACATGGTGCGCCGCATCATGGGCACGCTGCGCCCCATCGGCGAAGGCACATACCCACCACTC
CGAATGAAGCAGGTCCTAAATGGCGAGATTGAGCCCGGTCCATCGGCGCCAACTAAGGGGCTCTGGTTGCATCGCACGTGGCTGACGCAAGAAGACTGGG
ATGCAGATGAGACGCGTGATGACTAA