Transcript Name :
Pytul_DAOMBR144PYU1_G000791
Orientation:
(+)
Number of Exons:
1
Description :
candidate b-glycosidase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-789
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K05349
K05349
K05349
Cluster Id
17
Sequence
        2370 bases(100 bases per row)
ATGACGCAATTGGATATCTACTCGATGGTGAATGGAGACGTCCGCGATCCCGCGCGCGCACTGAACAAAGATGTCGTGACCAAGTACGCCAAGGCCGGTA
TCGGTTCAATCCTGAACGCTCCGTTCAATGGCCGCATCACTGATGGGCGTACGGGGTGGAGCGCAGCCGAGTGGAAACAAATTATTGACCAGATCCAAGG
GATCTACAAGCAATACAACCAAATTCCGATGATTTACGGTATCGACACTATCCACGGCGCAACATACGTGCGTGGTGCGACGCTGTTTGGCCAGCCGATC
AGTGCAGCATCGTCGTTCAACCTGGACTTGGTGTTCCAAATGGGCGAAATCGAAGCCAAAGATACGCTCGCGGCGGGCATCCCGTGGGTGTTTAGTCCCG
TGTTGGGAATCGCAGTGCAGCCGCGATGGGCGCGTGTGTTCGAGACGTTTGGCGAAGATCCGTACGTGTCGTCCCGCATGGGTGCATCAATCATTCGCGG
TATTCAGAGTACAGGTCAGGTCGCAGCGTGCATGAAGCATTTTATTGGGTATTCGAATCCAACGTCTGGCCTTGATCGCGCCGACAACGTGATTTCGGAC
TGGGACCTCGTAAACCATTTCGCACCATCGTTCTTGGCCGCGATTTTGGAGGGCGGCGTGAAAACCGCCATGGAATCGTACATCTCGATCAACGGCGAGC
CCGTGATCGCGAGTCATCGACTGCTCACGACGTTGCTGCGCTACGACATGAACTTTACGGGTATGCTCGTATCAGATTATTCGGAAATCGATCGCATGCA
CTCGGAGCATCACTTAGTACCGAGCGTTGCTGATGCCGTGCGCGTATCGCTCACAGAAACGTCTCTAGATATGAACATGGGACCCAACATGGACGATTTC
CTTAACATTGTCGAGAGCCTTGTGGTAAGTGGCACGCTCCCAGAAAGTCGACTCGATGAATCAGTTTTGCGAATTCTCCAATTGAAAAAAGATCTCGGAC
TCCTCAGTCAACAAAACGAGAAGGATAACAACGTTGCATCACCATCAAGCGCCTCTGCCATGGATGTCGGCAGCGCTGACGACCAACGCGTCGCTCTGGC
GTTGGCACGGGAATCAGTGATCTTGCTTGAAAACCGGAACCAAACACTCCCGATTCAGCTTTCAGCAGGAGACGAGAACAAGAATATGAATATTTTCATC
ACTGGCCCGATCTCCAACAACAAAGGGTACATGTGTGGCGGCTGGTCGGTCTTTTGGCAGGGTTCGTCGAATTCATCGCATTTTCCGAATGGCATGACAT
TTAAAGACGCCATGATCAAGCGCGCGGCTGCAACAACAGCACGAAACATTCACATCGAGCACCTCGATGTCGTTGATGTTGATGGCAACATGTCTGGAGA
GGATTATGGAAAAGCTGTCGACATCGCCTCACGAAGCGAGTACACGATCGTGGTGCTCGGTGAGGGCAACTACGCTGAGAAAACGGGGGACATTGCAGAT
CTTTCGCTGCCCGAGGGTCAACGGAAGTACCTACACTCCTTAACCCAGCTCCCATACACTAAAGTGATCGTTGTGTTGATCACAGGCCGGCCGCGGTTGC
TATACGGGTCGCATGACGACGCGGGTGCCGTGCTGTTGAGTATGCTACCATGTGAACAAGGCGGCGAAGCACTCGCGGATATTGTGTTTGGGGATGTGAA
CCCATCGGCAAAGCTCCCGATCACGTACCCGATCGCTGAGGGCAAGCTCTTGCCGTACTTCCACTATGTCAACACGAAGTGCCAACCATGGGATGAATGT
CCCGTGCAATGGGAGTTTGGCTATGGGCTGAGTTACACCCAGTTTCACTATTCGGACCTGAAATTGAATGCGACGACCGTGAATGGTGCCGATGGAGCAT
TACAAGTCGATGTCACGATCAAGAACACGGGTATTGTGGACGGCAGCGAGGTCGTGCTTCTTTTTGTGTCCCAAAAGTACCGTTTTGCGCACGTGCCGGA
AACGAAATTGCTCAAGAAGTTTCAAAAAGTGCACTTGAAAGCTCAGACAGCAACACAAGTCTCGTTTGTGCTGAATGTGAACGACTGGGGCTTTTATGAC
CCTGAGATTGGAACCGGGTTTCAACGTCGATTTGAAGCTGGTGAGTTTGAAGTCTCGATTCTGCAGAGTCTCAACGAAGATCAGAAGCTAGCAGCAACAG
TGGCAGCGTTGAATACAGCAGAAAGCAGTGATGACGGCAGCGACGCTCCCATGGGGCGTGATGGTCAACGTGAGTCTGTGCGCAGCCGATCCCGATCCCA
ACCACGGAAAATGTCGTCTTTACGCACAACGTTCCGCGTTCTCGCACACAAGACGCCAAGAGAACCATGA