Transcript Name :
Pytul_DAOMBR144PYU1_G000828
Orientation:
(-)
Number of Exons:
4
Description :
Similar to qdpr: Dihydropteridine reductase (Dictyostelium discoideum)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-240
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00357
*** None ***
Sequence
        1043 bases(100 bases per row)
ATGGCGGCAGCCAAGAAGCTCGTGGTAGTAGGCGGTGCCGGCGCGCTCGGACGTGGCATCGGCGCGCACTTTACGCGCGCATCCGCATGGAAGACGCTCT
CAGTGGATTTTACGCCCAACGACGACGTCGACGCGAGCTTCGTGTTTGACCGCGCGGCGTCGAGCACACTGACGCAGGCGAGCGCCGTGCTGCAGCACAT
CAAGGACACGTACGCGCTGAGTTGTGCTCATGTGCGTTTTGCATGCGAGGTAGTGGTGATCTGACGTGATGGTAACGTGCAGGTATGGTCAAGTGGATGC
CGTCGTGTGCGCTGCTGGCGGCTGGGCCGGAGGCAGCATCAAAGACGCAGACACGCTCGTGAACCTCGCGCAGATGCACTCGCGCAACACCGAATCCGCT
GTCATGGGTACGACCATCTACTATTTGGCATGCTCGTGCAAATGCGACTCATGGTGTTGTTGTGGTTTGCATGTGTAGCTGCTCACCTCGCGAGCCATGT
GCTGAACCCCGGTGGGCTGCTTGTGCTCACTGGCGCTGCTGCTGCTCTAAAAGGTACGTTTTGCTGTCTTTTTCGTGTGGGTTTTATGCATTTATGAGCA
TTAACATCCGTATATCTATCCTTTAACAATTTAGCTACGCCTGGCATGGTGTCGTACGGGATCAGCAAGGCTGGCACGCACCACTTGATTGCGAGCAGCA
TCGACGCGCTGCCCGAGGACGCGACGGCGCTCGGCGTGTTGCCTGCGACGATCGACACGCCGATGAACCGCAAGTTCATGGCGGACGCCGACTACGCGTC
TTGGACCAAAGTAGACGCGATCGCGGCCAAGATCCTGGAGTGGTCCAATGCATCGCCTTCGTCCCGTCCGCCAAATGGCCACTTGCTCACGGTGCTCACG
AACAACAACGTGGACACGTGGGAGGACGCCGGGAACCCGTTCCTTTAAGGCGTTGTTCTCTATATGGTCTATAATCTCTGCATTTCTGTCGACGCAGGAG
CCCCACATTTTTTAATGCATCACAGCCGCAATTTCGCCGTCAG