Transcript Name :
Phyke_g4876
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_320526
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Sugar/inositol transporter1.2PR00171
Sugar/inositol transporter1.2PR00171
Sugar/inositol transporter1.2PR00171
Sugar/inositol transporter1.2PR00171
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain32.05PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
InsideOutsideTMhelix
114-119
167-177
238-294
355-360
411-422
470-493
1-90
140-143
201-214
318-331
384-387
446-449
91-113
120-139
144-166
178-200
215-237
295-317
332-354
361-383
388-410
423-445
450-469
NN-scoreoddsWeighted Score
0.5961.6330.003
*** None ***
TypeScore
endoplasmic reticulum667
GO
Biological ProcessGO IDPrediction Method
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        1482 bases(100 bases per row)
ATGTACCTCGAGGTCGTTGCCACACCCAACAAAGGTGTTGGTGTCCACATCAATGCGTTCGATGACGCCACGAAGGTCGCCGCACACCAACTCAAGCCCA
AGAGACTCCTGTACACGAGTGTTCTGGTCTCACTATTACAACCGTTCCAAAGCGGTTGGTCGACCTCGCAGATGAATCTGTCGCAGTACAACGATACGGC
CCAGTGTAATGCTCGTCCTGTGGCTGAAGGAACGTGCCTCATGTTCCCTGGCCACTCGAAGCTAGAGTGGACATTCGCAGTGAACGCATGGATCTTCGGT
GCTATGATCGGTTCTCTGTGCTGCGGCTACTTCAGCGACAAGCTAGGTCGCAAGAAGGTTTTGATGATCAACTGCGTCTTCATGATCGTTGGCGGCATGA
TCCAGGCGACCGTGTCCAACATTTGGCTGTTCGCCATTGGCCGCCTCATCGCCGGCTTGGCGTCGGGTACAGCCACAGGTACGATTGGTGCGTACGTGAA
CGAGCTATCGCCACCGCACATGCGCAACACGCTGGGTTTGGGTCTGCAGATTTCCACGACCATTGGCATCCTGCTCCCAGCCATTgcattcttcttcgcg
aaTACGAGCAACGGGTGGCGATATTTGGCAGCTTTCCCGTGTGTGCTGGGCGCGCAATTCTTGCTCCTAGCCCCGACGCTGAGTGTGGAGAGTCCAGCGT
GGCTATTGACAAAGAATCGTCGTGAGGAGGCACGGAGGGTCATTGCGCGCTTGTACGGCGAAGAGAATGTAGGCACAGTTTTGTCCTGGCTTGAAGTGGG
GAACAAGGCAGCCAACGCTGAGCTGGGTAGGATTGCTGGCGAGCCGCCTGTGAATGAGTCCATGTTTGCCCCGCGCTACCGCCTCCAATTGGCAGGTGCA
GTCTTGCTTTCGTGCACACAGCAGCTCTCGGGCATCAACGCGGTGTTCTACTACTCCGGCACTATTTTCTCGGACGCCGGTATCTCAGATTCGCGCGTTG
GCACCTTGATCATCAACTTCATTAATATATGGCCTGCGTTCTTCACGGGAGTGCTGGCCGTCCGCCTAGGCAACCGTAACATGATCTTGTGGGGGTTGGC
AGGCATGGTGGCGATGTCGATCGGCATGACGGTGGCATTTATCGTCGATGTATCGGTGCTGTCGATCGTGTTTACAGCTTTGTACGTGATTGTGTTCGGC
GTGACGTTGGGCCCTTTGGTATGGGTGATGACCGCCGACATGTTCCCGGATTCTATTCGCGCGAGTGCGTCGTCGCTGTGTATTGGCATCAATTGGTTGT
GCAACCTAGTCGTAGGCGTGTCGTACCCGTACGTCTCGGATGCTCTTAACGGCTACGCGTACGTGCCATTCGTGGTGCTTTTGGTGATCTTTTACTTGCT
GGcgctgaagctggtgccgGAGACATCAGGTAAATCTGCTGAGGAGATTCAAGCAGAGTACGACTCGCGTCGCGAAATGTAA