Transcript Name :
Pytul_DAOMBR144PYU1_G000575
Orientation:
(-)
Number of Exons:
3
Description :
Similar to RAPGEF4: Rap guanine nucleotide exchange factor 4 (Homo sapiens)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1114
NN-scoreoddsWeighted Score
0.5011.2360.002
PositionContextScore
47GFSRAAR|SV0.742
970LAARHRR|SL0.774
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        3450 bases(100 bases per row)
ATGAAGACGATGGTGCGGCCACCGGGGCTCATCGCTCCAGAGCAGGACGAGAGAGTTCTACCAGACCCTGCTGCGTCAAAAGCGCCATCGAGTCCAACTT
CGTCAGCCAACAAGCACGTGGGCTTCAGTCGCGCCGCGCGGTCCGTGATCTCGCTCCAGAAGCGGCAATCGCAGATCACCGAACACGACGACGAGGATGC
AAATGAACGAGACGAGGTACGAGGCGCCACCCAGACAGAGCAGCCGGATTCGTGGGCGTCGGTGCTGAGCAAAGTCGCCAAGAAAACTGGCGCCACCGAC
CGCGTCCAGACCCCCACAGCCTCAGCAGCGACAGCAGCAGCAACATCTGCAACGACAAGCGGGGACGAGTCGCACGCGCAGGTCTCGTTGGCGCACATGC
TCCGGAGCCGCGAGGTCAAGAACTTCGTCAAGCAGTCTGTGGTCACGAGTCGCTGGAACAAGCAAGTGCTCCAGTCGTCGTCCGCTTTGTCGCCGCTGCA
TGAGAGCGGCCAGTCGACTGTCATGGAGCACTGGGTCAAGACCACGATGCTACGCAACCAGGCCGATGTCAAAGAAGCGGGCTTGGGGAGCGACGAGGAC
GACGACGAAGACACGCTCGCGGGTATCGAGTCGGGCTTCGACGTGCGCGCGTCCAAGACGAGACACATGTACGGCCGCACGCTGCTGCTCGAGGAATCGT
GTCGCCGCGCGTTCGCGCAGAGCAGCGAGAACCGGTCGCAGATGGATCTTCAGGCGCTCAAGGCGTGGTTCCAGATGACGAAGCTCAAGATCACGACGGA
CTTTGAGCGGCTGCAGCCTGCAGAGCTCGATCTGCTCTGCCGGCGCATGACGCTCGTGTCGTTCCACCCGAAGGAGATCGTGTTCCGCCAGGGTGACGAG
GGCGACGCGCTCTACCTCGTGTTCTCGGGCTGCGTCGAGGTTCGCGTGAGCCAGCAGATCCTGGGCGAGAAAGTCGAGGTCACGGTGTGCGAGTTGTCGA
AAGGCGACTACTTTGGCGAGCGCTCGCTGCTGAACAATGACGTGCGCGCCGCGACCGTGACGGCCAAGGTTACGACGGATCTCGTGCGCATCTCGCGCAA
GGACTACAACATCATGCTCAAGAAGGACCAGATGGAGTTTCTCTCGCGCATGCAAATGACCAATGGCCTCGTGATCCCCAAGTCGGCGCAGCAGTCGCAG
CGCGAGTACATCCGAGTGCTTACGAAGAAGAAGAATACGCGCACCAAGACCGACATCGACATGCTCAGCGAGTACCTCCAGACGCTCAAGTTTTTCCGCG
CGCTCCCGAAAACGTTTGTGCGCGAGCTCTGCACCGTTGTCGACTTTCTCAAACTGCCTGCGGGCACGTGCGTGTTCAAAGAGGGCGAAGTGGGCGACTT
GTTCTATATCATCTTCACGGGCTCGGTCGACGTGATTGTGAGCTCCAAGGATTTCCGCGGCAACGCGCAGCAGACCAAGCTCATCAACCTCACCGAGGGC
TCGCACTTCGGCGAACTCGCGCTCATGAAGGGCCACGGCATCCGCAGCGCCACGGTGATGACTCGCGAGGAGTGCCGCTTCCTCATCATCTGCGAGCGCG
ACTACAATGCGACACTGCGCAGGATGCAGAAGGAGGATCTCGCCAAGCGCGTCGGCGTGCTGGACAAGATCTCGATCTTCCAGACACCCGAGTGGACGGG
CGAGCTGCTCAAGGAGATGTCGTACGTGCTCTCGGAGCAAAAGCTGCCTGCGAGCAGCGTGCTTTTCAAGCAGGGCGACAAGGCGCTTCAGGTGTTCTTT
GTCGTGCGCGGTGAGCTCGTGATGACCAAGGAGATCGTGAACCCCGTGACGCACGTGACGCAGCTCGCAGTCGTGGAGCGCGTCGGTCGGTACCGCGTCG
TCGGCGATGATGCGTACGTTGGACAGTTTGGCGTTAGATTGCGTGTCCATTTTCCCCCCAAGCATACTAACCAAAGTCGTTTGTGTCTATGCGCTTGAAT
TTAGAGCGGCCGGGACAACGTTCAACGAGAGCATCCTCCGCGAGGTAACGGTCACGGCGACCACACCCGTCGAGGTGCTCATTCTGTCCAAGTACGACGT
GTTCCATCGGCTGTCGCGTGCCGCGCGGGAGGCGCTGCGCACGGCCGCGCACCTGCCGTCCGAGAGCGTCGTGTACCTCGACCGGTTCCACAAAACGGAG
AAATGGGAAAAATACAAGCACAAAGTGCTGCAAACGCACGTGAACCGCGAGCGGCTCGCACGGATTCTGCCTCCTGCTGCGAAGAATGACGAGACGAGGC
AAGAGCAGCGTCGGAAAAAGCTTCAAGCGAGCACGAAACCTGTAGTTGAGGCTCAAGGTTCATCTTTGAAGGACACTCTGAGCCAAAGTCAAAGTAGCAA
CGACATCCCGGAGGAGGACATGCGGGAGCTCATGGCGCACAAGAATGTCCTCGTGGACGCCAATGAGTTCATACTGCTGCCACCCCATGACAGAGCGATG
GGCGCGAGCCATCGCGCGACGACGACGATAGGCCACTTTGTGTCCACGTTCAATGCAGACGCGCCGCCGAGTGTCACACGCAAGACACAGTTGGAAAGCG
TGCTCGTGGCCGAGCGGCGGCGCCAAGTGGCGGTCCTGAACGAGGGCAATCCGCTGACGTACTTTGACCTGGAGGCCATCAAGCAGCAGGAGAAGAAGCA
CCACGCCGAGGCGCGCGGAAGAGCCGTGAGCACGCGACGCACGCTGCTCATCGGAAAAGAAGCAACGGCCACACTCCACAGCAGTGGAGGACCGTCGAGT
CCGTTTGGTTCGTCATCGATGGACGATTCGCCGTTACTGCTGCCGTCGTCATGTTCGTCGGCCTCGTCTGGCGCGTCGACAGCACTTGTCGACAAAGTTG
CGACCAAGGTCATGAACCAGCTGGTGCAGGAAAACTTTATCTTTTCGCGACCCGAGCGAATGGGCGACAGCGAGGCTTTGCTGGCCGCACGCCACAGGAG
AAGCCTCACGAACCAGTCTCGTCAGCACGCAGACGATGGCGTTGATGCTGCGAGAGAGATCACGCTGCAGCGTTGCGAAGGCGGCTTTGTGCTCCTGCGC
GTGGCCACGGCTGGCGAAATCGGCCATGACGAGCAGCAGCATGTGCGCACGCTGCAGTCGCCCACGCTGCAGATCCTTCGCGCCGTTGAGTCGGTTGCTC
AAGCTCGAGAGATCATGATTGCGACGCTCGTCAAGGAAGCGCGGCAACTCAAGTCCCCACATTCAGGACAAGATGAAGCGCAACCAGAAAGGACCGGAAG
CCTAGGATTTGGGGCGTTTTACGTCCTGCACAAGAAGAAATACGCCGTGATGCCGCGCTCAGCGTTGCCTAGATCCTCGGAGGAAGCGCTGCAGAAGCAT
CTATTCGATGCGTTTGCGAAGGCGTCGAGTGTGAGTAGCAGCAGCGCTAG