Transcript Name :
Pytul_DAOMBR144PYU1_G000573
Orientation:
(-)
Number of Exons:
1
Description :
Similar to ALA3: Phospholipid-transporting ATPase 3 (Arabidopsis thaliana)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
210-399
470-993
1048-1076
1134-1139
1205-1384
1-186
423-446
1014-1027
1100-1113
1163-1181
187-209
400-422
447-469
994-1013
1028-1047
1077-1099
1114-1133
1140-1162
1182-1204
*** None ***
PositionContextScore
75DSGRHKR|TL0.786
1230VEKRKRR|LT0.5
*** None ***
GO
*** None ***
*** None ***
Cluster Id
12
Sequence
        4155 bases(100 bases per row)
ATGGCGTCCAAGGGCCGGCTATTCGGCGGTGGCGGCCCGCGCGTGGAAGACGAGGAGCTGCTGCGGCACCAGACGCGCTCCACGAGCGCTGGGTCCAACC
CGCCGCTGCTCACCAAGGAGAGCAACTCGTCCTCGGACTACGTGTACGCTGAGATGGGCAGCCCCGCGCTGCTCCAGCAGCCGCAGCGAATCGGCGACGC
GGACGACAGCGGGCGCCACAAGCGTACGCTCACCGGTGGCGGCGGCGGCGGCAAGCTGCCCGCGACTAAGAACCGAGGCAACAGCCGCACAGGCCCCGCG
GCAGTCGGCCACGATTACAGCAATAATAATAACGGAGGAGGCGACAGCGACAAGGCCAAGCAGGAGCTTCGCGAGGTGTACTTCAACTACGCGCCGGGCA
ACGCCGTGTTTGACAAGAGTACGAATGTCGTGATCACGTCCAAGTACAACGTGCTGACGTTTCTGCCCAAGTTCCTAAAGGAGAGCTTCACGAAGGTGGC
GAACTTTTTCTTTTTGGTCGTGTGCGTGCTGCAGTCGATCGATTCGATCTCCAACACGTACGGCGTGCCCACGAACGCGCCCGTGCTACTCTTCGTGATC
TCGATCGACGCCGTGTTCGCGATCATGGAGGACATGCGGCGCCACACGTCCGACCGCGAGGCCAACTCGGCGAAGTGCCACATCGTGCGCAACGGTCACA
TCGAGGACCACCTCTGGTCCGAGGTCAAGGTTGGCGACTTTCTGCAGATCCGCAACCGCGAAGTGATCCCCGCGGACGTGCTCATCCTCTCGGTCTCGGA
GCCCGTGGGCGAGGCCGCGAGCGGCATCTGCTACGTCGAGACCAAGAGTCTGGACGGCGAGACGAACCTGAAGCTGCGCCAGGCCATCCAGCCGACCATG
AATGCGCTCGTGAACCCGCAGGAGCTCGTGCTGCTGCGCGGCATCGTCAAGTTCGAGACGCCCAACCCGTATATCAACAAGTTTGCCGGTAAGGTCGAGG
TGACGGTGAGCGAGGGCTGCGGCATGGAGGTCATGCCGCTGTCGGTCAAGAACGTGCTGCTGCGCGGCTGCAACCTGCGCAACACAGACTGGGTCTTTGG
CCTCGTGCTCAACACCGGGCCAGACACCAAGATCATGCAGAGCGCGAGCGCCGCGCCGTCCAAGTGGAGTGACGTCATGCTCTCGATGAACAAGATGATC
GCCATCCTGTGCTTGGGGCTCTTTGTGGCCTGCGCCGTCGCCGCCACCTGCTACGTCACCTGGCAGTACGACATCGTGCGGAATACCTGGTACATCAAGC
TCAGCGACGACGTGCGCGCGCAACCGCGCTGGGAATCGTTCATTCAGATGATGTTTTACTACTTTCTGCTGCTCTACCAGGTGATCCCGATCTCGCTGTA
CGTGTCCATGACGAGCGTCAAGTTCCTCCAGGCCAAGTTCATGGTCTGGGACCTCGAAATGTACCACGCCGAGACCGACACGCCTGCGATCGTGCGCACG
ATGGCGCTGAACGAGGAGCTCGGCCAGATCTCGTACGTGTTCAGTGACAAGACCGGCACGCTCACTTGCAACATCATGGAGTTCCGCAAGTGCTCGATCA
ACGGCATCTCGTACGGCTCAGGCATGACGGAGATCGGTCGCGCGGCGCTCGTGCGCGCCAACAAACCGATCCCGCCGGAGCCAAAAATGGACGCGGGCAT
GAAGAAGATGCAGTACGTCAACTTTGTGGACCCGTCGTTCTTCAAGGCGATGAATGGAGGCACTGGTGCGGCCCAGCGCGACAACATCCACCAGTTCTTT
GAGCACTTGGCCGTGTGCCACACAGTGATTCCGGAGAAATTGGAGACGGGCGAAGTACGTTTGTCGGCGTCGTCGCCCGATGAGCAGGCTCTGGTGGCTG
GTGCGTCGTTCGTGGGCTTCAATTTCGTGAATCGAGGCGTGGGCAAAGCCACGATCGAGATATTTGGCGAGCGCCAGGTGTTCGATATCCTCGATGTGCT
CGAGTTCAACAGTACACGCAAGCGCATGTCGGTGGTCGTTCGGCGGCCCAATGGCGAGTTGTATCTGTACTCAAAGGGTGCCGACATGATGATCTATCAG
CGACTGAAGGACGACCCGGCAATGGACCAGCTCAAGAAAGTCACACGAGATCACATGGAGAAGTACGCTGACGACGGCCTGCGCACACTGGCACTCGCGG
TGAAGAAACTGGACGAGAAATGGTTTCAGAAGTGGAAGATCAAGTTTGACGAAGCACAGGGCAACGTTGCCGAGCTCGACCGGCGAAAAGACGGCAAGCC
GAACGCGATTGACTCGCTCATGGAGGAGATCGAAGAAAATCTGGAGCTGATTGGCGCGACAGCGATCGAAGACAAGCTCCAGGATGGCGTTCCAAAGTGC
CTCGCGCACCTCACGGCCGCTGGCATCAAGGTGTGGATGCTCACAGGCGACAAGGAGGAGACGGCCATCAACATTGCCTACGCGTGTTCGCTCTTGGACA
ACTCGATCCAGCAAGTCATCGTCAATTGCACGACGTGTCCGAACGAAGAGGCCATCATCGCGCGTCTCAACGCCGCCGGACGCGAGTACCGCGAGAAAAC
CAAGGCCGACTCGAAGCTCGAGATCTCGCTGATCATCGACGGTGAAGCGTTGGAGTGGGCATTGAGTCCGCGCACGGCGCCGCATCTGCTGGAGTTTACG
AAATTGTGCCGCGCAGTGATTTGCAATCGCGTGTCGCCCGCGCAGAAAGCCGAGATGGTGCGGCTTGTGCGCGACAACATTCCAGTGGCGAGGACACTGG
CGATCGGCGATGGCGCCAACGATGTCGCGATGATCCAGGCTGCACACGTCGGCGTCGGCATCTCGGGCCAAGAAGGTATGCAGGCAGTCAACTCGAGCGA
CTATGCGATCGCGCAATTCCGGTTCCTCGAGCGATTACTGCTGGTGCACGGCCGCTGGAACTACATTCGCATCTCGAAGCTTGTGCTGTACATGTTTTAC
AAGAACATCACGCTCGTGCTGGCGCAGTACTGGTACGGCTACCTCTCGGGCGCGTCCGGATCGAAAATGTACTGGGAGCTCGGTGTGCAGGTGTACAACG
TCGCGTTCACGGGCATCCCGATCATCATGGTCGGCGTCATGGACAAGGACCTGCCGGCGCGGTTCAGCATCGAGTACCCAGATCTGTATCGGAAGGGGCC
GGAGCGGTACTACTTCAACATGTACACGTTCCTGCGCTGGGTCGGCGCCGCCGTGTTCGAGTCGCTGGTCATCTTCGTGGTCATGTCGTACGGCTTCAAC
GCGTCCGAGTCAGCGCCAGGCAGCGAGTCTCGCGTCGAGTACGGCATGGTAGCGTTCTCCATGACGGTGTTGATCGTGAATATCAAGATCTGGTTGATCT
CGGATACTTGGACGTTTCTGTCGTTGATATGCTGGTCGCTGAGCGTGCTGTCCTGGTTCGGGTTTGCGGCCATGGGTACGGAGGTCACGTTCTTCTCGCG
CTTTAAGGTCGCGTACGACGAGTTTGGCTCGTTCGCACCGACGGCGTGGTCCTGGGGGTACGTGCTCGTGGTGCTCATGGGCTGCGTTATTGCTCTGGGC
CGCCATTTCACGTACAACCAGTACCAGCGTGCTTTCTACCCGGAGCTGAACCAAGTACTGCAGGAATCGGTCGAGAAGCGGAAGCGCCGACTCACGATCA
ACCACATCGAGGAGCAGACTCTGTCTATGTCGCTGGATGACGTGCATGCCACAGCGTTCATGAGCGACTTCCGCGGCACAGACCTCACGGTGAAATCGTA
CCGAACCAACTCTGGCGGCGTCAACATGCACGACGCGATCGCCGAAGACGAAATCTATGAATCAAGTGGCGGGGGCGTGCCCAGTTTGGCCATGTCGGAC
AACGTGTCGCTGACGGCCGACAGCTTCTCGGCGAGCGTGTACAGCTCGTCGGTGTCTTCCGAGGTCGGCAGCGGATGGGACCGCATCCCGACCAAGTTGT
TCAAGTCGAACGCGTCGCGACGCAACACGGGGTACGCGTTCAGCTGCGACGAGGAGACGACGCTCGCCGAGTCGTACATCGCGTCCAACTCGCTGCCGCG
CTCCGACGCCGTGCCCGCGGCCCTGCGGAATTCCATCTCGCGGCACATGTCCTAA