Transcript Name :
Pytul_DAOMBR144PYU1_G000564
Orientation:
(-)
Number of Exons:
1
Description :
Similar to Os07g0646100: Probable protein phosphatase 2C 65 (Oryza sativa subsp. japonica)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-412
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1239 bases(100 bases per row)
ATGGCATTGCGTCAAGGAATCGCCAAGAGTGGCTCTGTCGCCAAAATCCGTCAGCAAGAAGCCACGGCAGCCAATGTGGCATCACCAAAGGGCATCTCAA
AGAAAACTCCGGGGATCTCGCCTTCGAAAGCTGGTATCAGTGACCACACGCTAGGACTCCAGCGTCGACGCTTGTCCGTCGTGAGTGATAACAAGCTTGT
CGAAGGCATGGCCCAGGTGTCCACCAGTGATGTGGACTATGTTGAAGATGGCACGAGCGCAGTCGCTGCGTACGCCGGGTTGTCGAAGAAAGGCTACGCT
CCGTACAACCCGCGCAAGAAGAACCAGGATTCGATGATCATCAAGCATGACCCTGAGTCTCGATCGCTTTTGCTGTGTGTGTTTGACGGCCATGGAGAAG
CCGGCGATGGTGTGTCCAACAGCATTCGTGATAAATACCCAACCGAATTGTTCAAGCACCCAAAGTTTGCGAGCTCTGGCAACTTGGCTGCGGACGCGGC
GAATATCAAGGCTGCGATCGGCGATTCGCTGCAAGTCGTCGAGAAAAACGTGATCCGCGATCCGTCGATAGACACAGAGTTCAGTGGCACCACGGCTGTC
GTTTCGGTTATTCGAGAGAATCTGCTGGTCGTGGGCAATGTAGGCGACTCGCGTATTACGAGGGGGTACGTTACGACCTCGGCAAGCGGCGAAGAAGTAC
TGGCGACCGAGTCTGTGTCGATCGACCACAAACCCGATCGCGCCGACGAGAAAGCGCGGATCGTCGCGAGTGGTGGACGTGTGTTTGCGGTCGAGTACGA
TGATGGCATTGACGGTCCTCCGCGCGTCTGGTTGGGTCACATGGACGTCCCGGGGCTCGCGATGTCGCGGTCGCTGGGTGACGCCGTGGCGCACACGGCG
GGCGTGGTTTCGGAACCCGAGTACTTTACCCGCATGCTGGATGACAGTGACCGGTGCCTCGTGATCGCGACCGACGGGCTCTGGGAGTTCATGTCGAACG
AAGAGGTGATCGAGATCGTGATGGCGCAGAAGGACCCCAAGGTCGCTGTGGACCTGCTCATCATGGAGGCCAACCGCCGGTGGATGAAAGAGGAACAGGT
CATCGACGACACGACCGTAATCGTCGTGTACGTGAACATTAACGAGATGGTGCCAGTTGCAGCCGTTGGTACCTTCAGTGGAGGAGAAAGCACCGCTGTT
ACCGCAATGACGCCACCCCCAGCTCAAGTCACGGCGTAG