Transcript Name :
Pytul_DAOMBR144PYU1_G000572
Orientation:
(+)
Number of Exons:
4
Description :
Similar to SFT2D3: Vesicle transport protein SFT2C (Homo sapiens)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
159-164
216-231
1-135
184-197
136-158
165-183
198-215
NN-scoreoddsWeighted Score
0.7012.3620.005
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
Cluster Id
1871
Sequence
        1385 bases(100 bases per row)
ATGAGCAGCGCATGGGAGCAGTGGGGCGCCAAGCGGCCGGCGAACGGTGGCGCGCAGGACGCCTTCCAGAGTCTGTTGCGCTCCTCACCGTTGGCTGCCA
CTGTCTCGTCCAGCGGCGAGAACGGCGCGTACTCGCTGCAGAAGATGTGGGACTCGGCGCGCGACCTCACCAAGAACGCCGTGAGCGGCATCGTGGTGGC
GGGCTCGCCCGCGAACTCGACGGTGTCAACGGTGGGCAGCGCGACGGACCTGGAGGCTCTCGAGAGCGGTCAGATGCGCGCAAGCGGCGGCGATACGAGC
GCCGAGGACGTTGAGAGCGCGACGGCGACATGGCCGTTCTTCCGTCGCAAATCGAATACCGAGAACGCACTGCTGCCCACCATGAGCTGGTGCGTGCATG
ATAAGGAGAAACCTATGGAGCTTGTGTATATGTGTAGTAACACTGACGCTCTTCTCTGTATGCTGCTGTGTATGTTTTTTTCTCATAGGAACACGCGGTT
CAAGTACTTTGTGGGCATGACGCTCATGGGGCTCATGTTTTTCGGCATGGCGTCCATTTTCCTACCACTGGTGCGTTCTTGATATATATATATATATATA
TAATCATATATGCAAGGAAAGCTGCTGATATGCCATGCGTTATATACATGCTGTAGATTATGATCCGGCCGTCCAAGTTCGCGCTGAGCTTCACGTTCGG
CAGCCTCTGCCTCATGGGCGCGCTGGCGATGCTCAAGGGCCCCGCTGCGTACGCCGCGAGTCTGCTGGAGCCCAAGCGCCTGCTGCTCACCACGGCCTAC
TTTCTGACGCTCGGTATGTCGCTGTCTGCGCTAATGTATAAATGCTGCCGTATTCACTAATTATATGTGTTTTACTACAGGCTCGACGCTGTATAGTTGC
TTGGTGCTGGGCAATTATGTGCTCGTCGTGTGCAGTTCGATCATGCAGGCACGTTGGTTTGTGTATTCCATACTTCTGCTTTATATGTGAACCTAACGAT
TGTGGATGCGCATTTTATCTATTTTCATTATAGCTACTCACACTCGCCGTCTTTGCGATGTCGGCACTCCCCGGCGGCAATGCGAGTCTGAAAGGTATCG
TTTTTGCTCTATTATTATCCATTGTATTCATCGCATATGTATAGGACTCATATGTTTATACCCTCCATCTCTAGCGTTTGGTATGGTGTTTATGAAAGCC
GCACGAGGCATGCTCCAGACGTTTGCGCGGCTATTCCGATAAATGCACGCAAAATGCGTTGCCATATAAGTAAGTACACGTTCAGATAAAGCAAAAGAAG
CAGATCCGACTGGACGCAGCACGATATGGCAGAAGCGATCGCATATTTCGATCACGACAAACGCCGCAAGAAACGCAGAGCATGG